🔥 | Latest

Af, Amazon, and Anaconda: His freedom ride home, he realized he was being adopted. He also tried to steal my cheeseburger @DrSmashlove Reddit u/3riny3s A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got aluminum in it 😖. Bro!! How u gon be a natural product and u got aluminum! I read the packaging closely and it said “naturally sourced aluminum.” FOH 😂. “We naturally select our poisonous metallic substances from the finest natural mines.” Aluminum is an ELEMENT. It’s pure. There is no difference between aluminum from recycled pepsi cans and aluminum from a mine. I was mad AF 😤. So I went back on my quest to find something natural. Well lo and behold Tom’s makes natural deodorant that’s called “wild lavender”. And lemme tell u - it smell pleasant asf! Like basically u slather it on and u sniff ya underarm and u magically transported to the soap aisle of Whole Food and a pleasant hipster girl with ear spacers, short hair, and a name tag that say “RAIN” smile at u 😍 (side note: was she born ‘Rain’? Or is her name Mandy but she adopted the name ‘Rain’ after attending burning man and dropping acid once? Maybe her Nani make it ‘Rain’? 😍 lmao I’m wild lemme stop 😂.) Caveat: if u work out hard AF like me, it will wear off a lil bit. Like for a 100 degree hot summertime Chi day u might could go with the Tom’s north woods aluminum joint. It will give u cancer-memory loss but at least u smell spicy 😂. Also and I done said this before: I shave my public hair which is a tradition among people of my faith. I know some of u women like “ew - DEALBREAKER!” WELL FU— just kidding! Baby girl that’s fair! 😂 I accept our incompatibility and hope u find the hairy Chewbacca lookin a$$ Man of ya dreams! 😍 Now then u men out here at the gym with the grapefruit sized amazon rainforest patch of stinky-ass underarm hair that drip white liquid on the elliptical, the ‘wild lavender’ may not cut it 😂. Y’all got that ‘built in’ stincc u probably need Mitchum. But if u down with that razor life it will give u plenty of protection against Le Stincc. May all of u live blessed and chemical free lives bless up 😍😂
Af, Amazon, and Anaconda: His freedom ride home, he realized he was
 being adopted. He also tried to steal my
 cheeseburger
 @DrSmashlove
 Reddit u/3riny3s
A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got aluminum in it 😖. Bro!! How u gon be a natural product and u got aluminum! I read the packaging closely and it said “naturally sourced aluminum.” FOH 😂. “We naturally select our poisonous metallic substances from the finest natural mines.” Aluminum is an ELEMENT. It’s pure. There is no difference between aluminum from recycled pepsi cans and aluminum from a mine. I was mad AF 😤. So I went back on my quest to find something natural. Well lo and behold Tom’s makes natural deodorant that’s called “wild lavender”. And lemme tell u - it smell pleasant asf! Like basically u slather it on and u sniff ya underarm and u magically transported to the soap aisle of Whole Food and a pleasant hipster girl with ear spacers, short hair, and a name tag that say “RAIN” smile at u 😍 (side note: was she born ‘Rain’? Or is her name Mandy but she adopted the name ‘Rain’ after attending burning man and dropping acid once? Maybe her Nani make it ‘Rain’? 😍 lmao I’m wild lemme stop 😂.) Caveat: if u work out hard AF like me, it will wear off a lil bit. Like for a 100 degree hot summertime Chi day u might could go with the Tom’s north woods aluminum joint. It will give u cancer-memory loss but at least u smell spicy 😂. Also and I done said this before: I shave my public hair which is a tradition among people of my faith. I know some of u women like “ew - DEALBREAKER!” WELL FU— just kidding! Baby girl that’s fair! 😂 I accept our incompatibility and hope u find the hairy Chewbacca lookin a$$ Man of ya dreams! 😍 Now then u men out here at the gym with the grapefruit sized amazon rainforest patch of stinky-ass underarm hair that drip white liquid on the elliptical, the ‘wild lavender’ may not cut it 😂. Y’all got that ‘built in’ stincc u probably need Mitchum. But if u down with that razor life it will give u plenty of protection against Le Stincc. May all of u live blessed and chemical free lives bless up 😍😂

A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got alumi...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Best Friend, Bless Up, and College: You can see the meaning of the universe in those two eyes. So my lil homegirl sent me a link to this coffee made by Dark Matter that’s called Unicorn Blood. Tried it. Not gon lie, delicious. But Unicorn Blood? Y’all doin too much. U coffee roasters Bruv a lot of y’all getting real comfortable selling good (but not life changing) coffee for $15.99 a bag and I’m thinking I might come for y’all. Coffee is my thing and if I had the time and the roasting equipment, I could stomp y’all out completely. And I know what I’d name my coffee blend, too: Mermaid Period. Y’all think Unicorn Blood is rare? Y’all ain’t seen rare. First of all a Unicorn is just a horse with a horn. That sh!t low key basic. A good plastic surgeon could make one. If a plastic surgeon could make the Kardashians Black bruv? He could throw a horn on a horse nah that’s basic. Mermaids? Bruv that’s half woman half fish. Up top she a sexy, comely ginger with seashells on her Tetas. Waist down? All flipper. Where’s the Punani? Exactly. Even if a mermaid had a Punani (which she can’t because issa flipper), would she even have a period? How? Do she wear faded, washed 7,000 times, soft-as-silk (😍) Period panty granny panties over her flipper? Or do she just freeball it bleeding out her sweet, precious, mythical, menstrual magnificence into the ocean with reckless abandon so that if a random scuba diver named Aiden from Newport Beach with floopy blond hair is swimming by and perchance catches a glorious taste, his heart explodes with love and affection and his head pops off his body and his scuba diving companion William is at his funeral just like “I know y’all will never believe me because I used to drop acid when I attended college but my best friend died after inhaling Mermaid Period then his head popped off his body and a shark ate it good night 😢.” Bam. Straight like that. It will be beautifully rich, reddish in color, deliciously fragrant, and invigorating - just like regular Period (But I’ll call it Mermaid Period because y’all love it when these beverage companies are extra 🤗). Coming to your grocery aisle fall 2018. Starbucks, Peet’s and Dark Matter - y’all on notice. Bless up 🤗😂😂😂
Best Friend, Bless Up, and College: You can see the meaning
 of the universe in those
 two eyes.
So my lil homegirl sent me a link to this coffee made by Dark Matter that’s called Unicorn Blood. Tried it. Not gon lie, delicious. But Unicorn Blood? Y’all doin too much. U coffee roasters Bruv a lot of y’all getting real comfortable selling good (but not life changing) coffee for $15.99 a bag and I’m thinking I might come for y’all. Coffee is my thing and if I had the time and the roasting equipment, I could stomp y’all out completely. And I know what I’d name my coffee blend, too: Mermaid Period. Y’all think Unicorn Blood is rare? Y’all ain’t seen rare. First of all a Unicorn is just a horse with a horn. That sh!t low key basic. A good plastic surgeon could make one. If a plastic surgeon could make the Kardashians Black bruv? He could throw a horn on a horse nah that’s basic. Mermaids? Bruv that’s half woman half fish. Up top she a sexy, comely ginger with seashells on her Tetas. Waist down? All flipper. Where’s the Punani? Exactly. Even if a mermaid had a Punani (which she can’t because issa flipper), would she even have a period? How? Do she wear faded, washed 7,000 times, soft-as-silk (😍) Period panty granny panties over her flipper? Or do she just freeball it bleeding out her sweet, precious, mythical, menstrual magnificence into the ocean with reckless abandon so that if a random scuba diver named Aiden from Newport Beach with floopy blond hair is swimming by and perchance catches a glorious taste, his heart explodes with love and affection and his head pops off his body and his scuba diving companion William is at his funeral just like “I know y’all will never believe me because I used to drop acid when I attended college but my best friend died after inhaling Mermaid Period then his head popped off his body and a shark ate it good night 😢.” Bam. Straight like that. It will be beautifully rich, reddish in color, deliciously fragrant, and invigorating - just like regular Period (But I’ll call it Mermaid Period because y’all love it when these beverage companies are extra 🤗). Coming to your grocery aisle fall 2018. Starbucks, Peet’s and Dark Matter - y’all on notice. Bless up 🤗😂😂😂

So my lil homegirl sent me a link to this coffee made by Dark Matter that’s called Unicorn Blood. Tried it. Not gon lie, delicious. But Unic...