🔥 | Latest

Lgbt, Omg, and Sorry: eli 27 @hometovn skittles did THAT HARE INE RAINBOW, TASTE THE RAINBOW LIMITED EDITION 2017-03-30, 2:51 PM LIMITED EDITION taste he Rainbow Cー っ SHARE INE RAINBOW, TASTE THE RAINBOW only one Rainbow mattets this PRide. Give the Rainbow, taste the Rainon KO MARS IRELAND UL PO BO 700 ROMARS IRELAND LUL PO BOX 3856, DUBIN4. Contact us: www.mars.co vireland1890 812 315 Cortactu露www.wn, 'ey.convuk 〇0800 028 7009 PORTIONS PER PACK/PORTIONEN PRO PACKUNG: 4 NUTR TION DECLARATION/NAHRWERT1009 1435 UKIRO CHEWY CANDIES IN A CRISP SUGAR SHELL WITH FRUIT FLAWOURS.ENERGIE NGIDENTSSGRUOSİS RUP PALM FAT, ACOS dTRIC ACID, MALCADO. DEXTRİN, MALTOOT RIN FLAVOURINGS, MOORED STARCH. ACIDITY REGULATOR TRISODIUN CITRATE, GLAZING AGENT CARNAUBA WAX COLOUR E1T2. PRODUCT MAY C ONTAIN AN UNEVEN MDX OF FLAVOURS UTABLE FOR VEGETARANS IEEP COOL AND DRY. BEST BEFOREe DE WRIGLEY GMBH, 0-82004 UNTERHACHING. Www.wR NKUSPRIGER ZUCKERHULLE MIT FRUCHTGESCHMACK ZUCKER GUNDSESIRUP PALMFETT SAUERUNGSMITTEL CITRO SAURE, APFELSAURE PROTENEWES 404 kcal 176 ka 429 T/FETT OF WHICH SATURATES 23g1 DAVON GESATTIGTE FETTSAUREN OF WHICH SUGARS/DAVON ZUCKER SALT/SALZ AGEES CARBOHYDRATE/KOHLENHYDRATE 0.029 | 001 TRINATRIUMCITRAT, UBERZUGSMITTEL CARNAUBAW CHS, FARBSTOFF E172 OAUWDTROCEN AUFBEWAHRENL MINDESTENS ALTBAR BIS: SIEHE BODEN REFERENZMENGE F REFERENCE INTAKE OF AN AVERAGE ADULT (8400000 t UR EINEN DURCHSCHNITTLICHEN ERWACHSENEN (8400 kJ/2000 kcal) l the lentils are white in celebeation of PRide. Enjoy the mystey ma. siite <p><a href="https://mornington-the-crescent.tumblr.com/post/175275365509/libertarirynn-holdtheskeletongrillby" class="tumblr_blog">mornington-the-crescent</a>:</p> <blockquote><p><a href="https://libertarirynn.tumblr.com/post/175274799494/holdtheskeletongrillby-snark-isms" class="tumblr_blog">libertarirynn</a>:</p><blockquote> <p><a href="http://holdtheskeletongrillby.tumblr.com/post/159326539360/snark-isms-ruinedchildhood-sorry" class="tumblr_blog">holdtheskeletongrillby</a>:</p> <blockquote> <p><a href="https://snark-isms.tumblr.com/post/159325434158/ruinedchildhood-sorry-but-all-i-see" class="tumblr_blog">snark-isms</a>:</p> <blockquote> <p><a href="http://ruinedchildhood.com/post/159077186704" class="tumblr_blog">ruinedchildhood</a>:</p> <blockquote><p>💯🌈💯🌈💯🌈💯🌈</p></blockquote> <p>Sorry but all I see is white pride. Am I missing something?</p> </blockquote> <p>They are always a rainbow, so they can’t be rainbow colored for LGBT Pride. Instead, they opted for a ‘you have to try each piece to learn the flavor inside’ thing, symbolic of you can’t always tell someone’s sexuality by looking. It’s gay pride with mystery Skittles. Nothing about white people.</p> </blockquote> <p>“White pride” omg</p> </blockquote> <p>Hang on, hang on.</p><p style=""><br/></p><p>Is nobody else going to point out the fact that individual Skittles are called “lentils”?<br/></p></blockquote> <p>Oh wow I didn’t even notice that. That is weird 🤔🤔🤔</p>
Lgbt, Omg, and Sorry: eli 27
 @hometovn
 skittles did THAT
 HARE INE RAINBOW, TASTE THE RAINBOW
 LIMITED
 EDITION
 2017-03-30, 2:51 PM

 LIMITED
 EDITION
 taste he Rainbow

 Cー っ
 SHARE INE RAINBOW, TASTE THE RAINBOW
 only one Rainbow mattets this PRide.
 Give the Rainbow, taste the Rainon
 KO MARS IRELAND UL PO BO 700
 ROMARS IRELAND LUL PO BOX 3856, DUBIN4.
 Contact us: www.mars.co vireland1890 812 315
 Cortactu露www.wn, 'ey.convuk 〇0800 028 7009
 PORTIONS PER PACK/PORTIONEN PRO PACKUNG: 4
 NUTR TION DECLARATION/NAHRWERT1009 1435
 UKIRO CHEWY CANDIES IN A CRISP SUGAR SHELL WITH FRUIT FLAWOURS.ENERGIE
 NGIDENTSSGRUOSİS RUP PALM FAT, ACOS dTRIC ACID,
 MALCADO. DEXTRİN, MALTOOT RIN FLAVOURINGS, MOORED STARCH.
 ACIDITY REGULATOR TRISODIUN CITRATE, GLAZING AGENT CARNAUBA WAX
 COLOUR E1T2. PRODUCT MAY C ONTAIN AN UNEVEN MDX OF FLAVOURS
 UTABLE FOR VEGETARANS IEEP COOL AND DRY. BEST BEFOREe
 DE WRIGLEY GMBH, 0-82004 UNTERHACHING. Www.wR
 NKUSPRIGER ZUCKERHULLE MIT FRUCHTGESCHMACK ZUCKER
 GUNDSESIRUP PALMFETT SAUERUNGSMITTEL CITRO SAURE, APFELSAURE PROTENEWES
 404 kcal 176 ka
 429
 T/FETT
 OF WHICH SATURATES
 23g1
 DAVON GESATTIGTE FETTSAUREN
 OF WHICH SUGARS/DAVON ZUCKER
 SALT/SALZ
 AGEES CARBOHYDRATE/KOHLENHYDRATE
 0.029 | 001
 TRINATRIUMCITRAT, UBERZUGSMITTEL CARNAUBAW CHS, FARBSTOFF E172
 OAUWDTROCEN AUFBEWAHRENL MINDESTENS ALTBAR BIS: SIEHE BODEN REFERENZMENGE F
 REFERENCE INTAKE OF AN AVERAGE ADULT (8400000 t
 UR EINEN DURCHSCHNITTLICHEN
 ERWACHSENEN (8400 kJ/2000 kcal)
 l the lentils are white in celebeation of PRide. Enjoy the mystey ma.
 siite

<p><a href="https://mornington-the-crescent.tumblr.com/post/175275365509/libertarirynn-holdtheskeletongrillby" class="tumblr_blog">mornington-the-crescent</a>:</p>

<blockquote><p><a href="https://libertarirynn.tumblr.com/post/175274799494/holdtheskeletongrillby-snark-isms" class="tumblr_blog">libertarirynn</a>:</p><blockquote>
<p><a href="http://holdtheskeletongrillby.tumblr.com/post/159326539360/snark-isms-ruinedchildhood-sorry" class="tumblr_blog">holdtheskeletongrillby</a>:</p>
<blockquote>
<p><a href="https://snark-isms.tumblr.com/post/159325434158/ruinedchildhood-sorry-but-all-i-see" class="tumblr_blog">snark-isms</a>:</p>

<blockquote>
<p><a href="http://ruinedchildhood.com/post/159077186704" class="tumblr_blog">ruinedchildhood</a>:</p>

<blockquote><p>💯🌈💯🌈💯🌈💯🌈</p></blockquote>

<p>Sorry but all I see is white pride. Am I missing something?</p>
</blockquote>

<p>They are always a rainbow, so they can’t be rainbow colored for LGBT Pride. Instead, they opted for a ‘you have to try each piece to learn the flavor inside’ thing, symbolic of you can’t always tell someone’s sexuality by looking. It’s gay pride with mystery Skittles. Nothing about white people.</p>
</blockquote>

<p>“White pride” omg</p>
</blockquote>
<p>Hang on, hang on.</p><p style=""><br/></p><p>Is nobody else going to point out the fact that individual Skittles are called “lentils”?<br/></p></blockquote>

<p>Oh wow I didn’t even notice that. That is weird 🤔🤔🤔</p>

<p><a href="https://mornington-the-crescent.tumblr.com/post/175275365509/libertarirynn-holdtheskeletongrillby" class="tumblr_blog">morningto...

Lgbt, Omg, and Sorry: eli 27 @hometovn skittles did THAT HARE INE RAINBOW, TASTE THE RAINBOW LIMITED EDITION 2017-03-30, 2:51 PM LIMITED EDITION taste he Rainbow Cー っ SHARE INE RAINBOW, TASTE THE RAINBOW only one Rainbow mattets this PRide. Give the Rainbow, taste the Rainon KO MARS IRELAND UL PO BO 700 ROMARS IRELAND LUL PO BOX 3856, DUBIN4. Contact us: www.mars.co vireland1890 812 315 Cortactu露www.wn, 'ey.convuk 〇0800 028 7009 PORTIONS PER PACK/PORTIONEN PRO PACKUNG: 4 NUTR TION DECLARATION/NAHRWERT1009 1435 UKIRO CHEWY CANDIES IN A CRISP SUGAR SHELL WITH FRUIT FLAWOURS.ENERGIE NGIDENTSSGRUOSİS RUP PALM FAT, ACOS dTRIC ACID, MALCADO. DEXTRİN, MALTOOT RIN FLAVOURINGS, MOORED STARCH. ACIDITY REGULATOR TRISODIUN CITRATE, GLAZING AGENT CARNAUBA WAX COLOUR E1T2. PRODUCT MAY C ONTAIN AN UNEVEN MDX OF FLAVOURS UTABLE FOR VEGETARANS IEEP COOL AND DRY. BEST BEFOREe DE WRIGLEY GMBH, 0-82004 UNTERHACHING. Www.wR NKUSPRIGER ZUCKERHULLE MIT FRUCHTGESCHMACK ZUCKER GUNDSESIRUP PALMFETT SAUERUNGSMITTEL CITRO SAURE, APFELSAURE PROTENEWES 404 kcal 176 ka 429 T/FETT OF WHICH SATURATES 23g1 DAVON GESATTIGTE FETTSAUREN OF WHICH SUGARS/DAVON ZUCKER SALT/SALZ AGEES CARBOHYDRATE/KOHLENHYDRATE 0.029 | 001 TRINATRIUMCITRAT, UBERZUGSMITTEL CARNAUBAW CHS, FARBSTOFF E172 OAUWDTROCEN AUFBEWAHRENL MINDESTENS ALTBAR BIS: SIEHE BODEN REFERENZMENGE F REFERENCE INTAKE OF AN AVERAGE ADULT (8400000 t UR EINEN DURCHSCHNITTLICHEN ERWACHSENEN (8400 kJ/2000 kcal) l the lentils are white in celebeation of PRide. Enjoy the mystey ma. siite <p><a href="http://holdtheskeletongrillby.tumblr.com/post/159326539360/snark-isms-ruinedchildhood-sorry" class="tumblr_blog">holdtheskeletongrillby</a>:</p><blockquote> <p><a href="https://snark-isms.tumblr.com/post/159325434158/ruinedchildhood-sorry-but-all-i-see" class="tumblr_blog">snark-isms</a>:</p> <blockquote> <p><a href="http://ruinedchildhood.com/post/159077186704" class="tumblr_blog">ruinedchildhood</a>:</p> <blockquote><p>💯🌈💯🌈💯🌈💯🌈</p></blockquote> <p>Sorry but all I see is white pride. Am I missing something?</p> </blockquote> <p>They are always a rainbow, so they can’t be rainbow colored for LGBT Pride. Instead, they opted for a ‘you have to try each piece to learn the flavor inside’ thing, symbolic of you can’t always tell someone’s sexuality by looking. It’s gay pride with mystery Skittles. Nothing about white people.</p> </blockquote> <p>“White pride” omg</p>
Lgbt, Omg, and Sorry: eli 27
 @hometovn
 skittles did THAT
 HARE INE RAINBOW, TASTE THE RAINBOW
 LIMITED
 EDITION
 2017-03-30, 2:51 PM

 LIMITED
 EDITION
 taste he Rainbow

 Cー っ
 SHARE INE RAINBOW, TASTE THE RAINBOW
 only one Rainbow mattets this PRide.
 Give the Rainbow, taste the Rainon
 KO MARS IRELAND UL PO BO 700
 ROMARS IRELAND LUL PO BOX 3856, DUBIN4.
 Contact us: www.mars.co vireland1890 812 315
 Cortactu露www.wn, 'ey.convuk 〇0800 028 7009
 PORTIONS PER PACK/PORTIONEN PRO PACKUNG: 4
 NUTR TION DECLARATION/NAHRWERT1009 1435
 UKIRO CHEWY CANDIES IN A CRISP SUGAR SHELL WITH FRUIT FLAWOURS.ENERGIE
 NGIDENTSSGRUOSİS RUP PALM FAT, ACOS dTRIC ACID,
 MALCADO. DEXTRİN, MALTOOT RIN FLAVOURINGS, MOORED STARCH.
 ACIDITY REGULATOR TRISODIUN CITRATE, GLAZING AGENT CARNAUBA WAX
 COLOUR E1T2. PRODUCT MAY C ONTAIN AN UNEVEN MDX OF FLAVOURS
 UTABLE FOR VEGETARANS IEEP COOL AND DRY. BEST BEFOREe
 DE WRIGLEY GMBH, 0-82004 UNTERHACHING. Www.wR
 NKUSPRIGER ZUCKERHULLE MIT FRUCHTGESCHMACK ZUCKER
 GUNDSESIRUP PALMFETT SAUERUNGSMITTEL CITRO SAURE, APFELSAURE PROTENEWES
 404 kcal 176 ka
 429
 T/FETT
 OF WHICH SATURATES
 23g1
 DAVON GESATTIGTE FETTSAUREN
 OF WHICH SUGARS/DAVON ZUCKER
 SALT/SALZ
 AGEES CARBOHYDRATE/KOHLENHYDRATE
 0.029 | 001
 TRINATRIUMCITRAT, UBERZUGSMITTEL CARNAUBAW CHS, FARBSTOFF E172
 OAUWDTROCEN AUFBEWAHRENL MINDESTENS ALTBAR BIS: SIEHE BODEN REFERENZMENGE F
 REFERENCE INTAKE OF AN AVERAGE ADULT (8400000 t
 UR EINEN DURCHSCHNITTLICHEN
 ERWACHSENEN (8400 kJ/2000 kcal)
 l the lentils are white in celebeation of PRide. Enjoy the mystey ma.
 siite

<p><a href="http://holdtheskeletongrillby.tumblr.com/post/159326539360/snark-isms-ruinedchildhood-sorry" class="tumblr_blog">holdtheskeletongrillby</a>:</p><blockquote>
<p><a href="https://snark-isms.tumblr.com/post/159325434158/ruinedchildhood-sorry-but-all-i-see" class="tumblr_blog">snark-isms</a>:</p>

<blockquote>
<p><a href="http://ruinedchildhood.com/post/159077186704" class="tumblr_blog">ruinedchildhood</a>:</p>

<blockquote><p>💯🌈💯🌈💯🌈💯🌈</p></blockquote>

<p>Sorry but all I see is white pride. Am I missing something?</p>
</blockquote>

<p>They are always a rainbow, so they can’t be rainbow colored for LGBT Pride. Instead, they opted for a ‘you have to try each piece to learn the flavor inside’ thing, symbolic of you can’t always tell someone’s sexuality by looking. It’s gay pride with mystery Skittles. Nothing about white people.</p>
</blockquote>

<p>“White pride” omg</p>

<p><a href="http://holdtheskeletongrillby.tumblr.com/post/159326539360/snark-isms-ruinedchildhood-sorry" class="tumblr_blog">holdtheskeleton...

Af, Amazon, and Anaconda: His freedom ride home, he realized he was being adopted. He also tried to steal my cheeseburger @DrSmashlove Reddit u/3riny3s A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got aluminum in it 😖. Bro!! How u gon be a natural product and u got aluminum! I read the packaging closely and it said “naturally sourced aluminum.” FOH 😂. “We naturally select our poisonous metallic substances from the finest natural mines.” Aluminum is an ELEMENT. It’s pure. There is no difference between aluminum from recycled pepsi cans and aluminum from a mine. I was mad AF 😤. So I went back on my quest to find something natural. Well lo and behold Tom’s makes natural deodorant that’s called “wild lavender”. And lemme tell u - it smell pleasant asf! Like basically u slather it on and u sniff ya underarm and u magically transported to the soap aisle of Whole Food and a pleasant hipster girl with ear spacers, short hair, and a name tag that say “RAIN” smile at u 😍 (side note: was she born ‘Rain’? Or is her name Mandy but she adopted the name ‘Rain’ after attending burning man and dropping acid once? Maybe her Nani make it ‘Rain’? 😍 lmao I’m wild lemme stop 😂.) Caveat: if u work out hard AF like me, it will wear off a lil bit. Like for a 100 degree hot summertime Chi day u might could go with the Tom’s north woods aluminum joint. It will give u cancer-memory loss but at least u smell spicy 😂. Also and I done said this before: I shave my public hair which is a tradition among people of my faith. I know some of u women like “ew - DEALBREAKER!” WELL FU— just kidding! Baby girl that’s fair! 😂 I accept our incompatibility and hope u find the hairy Chewbacca lookin a$$ Man of ya dreams! 😍 Now then u men out here at the gym with the grapefruit sized amazon rainforest patch of stinky-ass underarm hair that drip white liquid on the elliptical, the ‘wild lavender’ may not cut it 😂. Y’all got that ‘built in’ stincc u probably need Mitchum. But if u down with that razor life it will give u plenty of protection against Le Stincc. May all of u live blessed and chemical free lives bless up 😍😂
Af, Amazon, and Anaconda: His freedom ride home, he realized he was
 being adopted. He also tried to steal my
 cheeseburger
 @DrSmashlove
 Reddit u/3riny3s
A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got aluminum in it 😖. Bro!! How u gon be a natural product and u got aluminum! I read the packaging closely and it said “naturally sourced aluminum.” FOH 😂. “We naturally select our poisonous metallic substances from the finest natural mines.” Aluminum is an ELEMENT. It’s pure. There is no difference between aluminum from recycled pepsi cans and aluminum from a mine. I was mad AF 😤. So I went back on my quest to find something natural. Well lo and behold Tom’s makes natural deodorant that’s called “wild lavender”. And lemme tell u - it smell pleasant asf! Like basically u slather it on and u sniff ya underarm and u magically transported to the soap aisle of Whole Food and a pleasant hipster girl with ear spacers, short hair, and a name tag that say “RAIN” smile at u 😍 (side note: was she born ‘Rain’? Or is her name Mandy but she adopted the name ‘Rain’ after attending burning man and dropping acid once? Maybe her Nani make it ‘Rain’? 😍 lmao I’m wild lemme stop 😂.) Caveat: if u work out hard AF like me, it will wear off a lil bit. Like for a 100 degree hot summertime Chi day u might could go with the Tom’s north woods aluminum joint. It will give u cancer-memory loss but at least u smell spicy 😂. Also and I done said this before: I shave my public hair which is a tradition among people of my faith. I know some of u women like “ew - DEALBREAKER!” WELL FU— just kidding! Baby girl that’s fair! 😂 I accept our incompatibility and hope u find the hairy Chewbacca lookin a$$ Man of ya dreams! 😍 Now then u men out here at the gym with the grapefruit sized amazon rainforest patch of stinky-ass underarm hair that drip white liquid on the elliptical, the ‘wild lavender’ may not cut it 😂. Y’all got that ‘built in’ stincc u probably need Mitchum. But if u down with that razor life it will give u plenty of protection against Le Stincc. May all of u live blessed and chemical free lives bless up 😍😂

A few weeks ago I hyped up a anti perspirant called Tom’s North Woods. It smells absolutely wonderful and works great. HOWEVER. It got alumi...

Bad, Club, and Fire: This list of reasons for admission to a lunatic asylum in the 1800s reads like a list of potential metal band names... REASONS FOR ADMISSION 1864 TO 1889 INTEMPERANCE & BUSINESS TROUBLE DISSOLUTE HABITS KICKED IN THE HEAD BY A HORSE HEREDITARY PREDISPOSITION ILL TREATMENT BY HUSBAND IMAGINARY FEMALE TROUBLE HYSTERIA IMMORAL LIFE IMPRISONMENT JEALOUSY AND RELIGION LAZINESS MARRIAGE OF SON MASTURBATION & SYPHILIS MASTURBATION FOR 30 YEARS MEDICINE TO PREVENT CONCEPTION SUPPRESSED MASTURBATION MENSTRUAL DERANGED MENTAL EXCITEMENT NOVEL READING NYMPHOMANIA OPIUM HABIT OVER ACTION OF THE MIND OVER STUDY OF RELIGION OVER TAXING MENTAL POWERS PARENTS WERE COUSINS PERIODICAL FITS TOBACCO & MASTURBATION POLITICAL EXCITEMENT POLITICS RELIGIOUS ENTHUSIASM FEVER AND LOSS OF LAW SUIT FITS AND DESERTION OF HUSBAND ASTHMA BAD COMPANY BAD HABITS & POLITICAL EXCITEMENTSALVATION ARMY BAD WHISKEY BLOODY FLUX BRAIN FEVER BUSINESS NERVES CARBONIC ACID GAS CONGESTION OF BRAIN DEATH OF SONS IN WAR DECOYED INTO THE ARMY DERANGED MASTURBATION DESERTION BY HUSBAND DOMESTIC AFFLICTION DOMESTIC TROUBLE DROPSY EGOTISM EPILEPTIC FITS EXCESSIVE SEXUAL ABUSE EXCITEMENT AS OFFICER EXPOSURE AND HEREDITARY EXPOSURE AND QUACKERY EXPOSURE IN ARMY FEVER AND JEALOUSY FIGHTING FIRE SUPPRESSION OF MENSES THE WAR TIME OF LIFE UTERINE DERANGEMENT VENEREAL EXCESSES VICIOUS VICES WOMEN TROUBLE SUPERSTITION SHOOTING OF DAUGHTER SMALL POX SNUFF EATING FOR 2 YEARS SPINAL IRRITATION GATHERING IN THE HEAD GREEDINESS GUNSHOT WOUND HARD STUDy RUMOR OF HUSBAND MURDER SCARLATINA SEDUCTION & DISAPPOINTMENT SELF ABUSE SEXUAL ABUSE & STIMULANTS SEXUAL DERANGEMENT FALSE CONFINEMENT FEEBLENESS OF INTELLECT FELL FROM HORSE IN WAR FEMALE DISEASE DISSIPATION OF NERVES <p><a href="http://laughoutloud-club.tumblr.com/post/170236009410/quite-the-reasons-for-admission" class="tumblr_blog">laughoutloud-club</a>:</p> <blockquote><p>Quite The Reasons For Admission</p></blockquote>
Bad, Club, and Fire: This list of reasons for admission to a lunatic
 asylum in the 1800s reads like a list of potential
 metal band names...
 REASONS FOR ADMISSION
 1864 TO 1889
 INTEMPERANCE & BUSINESS TROUBLE DISSOLUTE HABITS
 KICKED IN THE HEAD BY A HORSE
 HEREDITARY PREDISPOSITION
 ILL TREATMENT BY HUSBAND
 IMAGINARY FEMALE TROUBLE
 HYSTERIA
 IMMORAL LIFE
 IMPRISONMENT
 JEALOUSY AND RELIGION
 LAZINESS
 MARRIAGE OF SON
 MASTURBATION & SYPHILIS
 MASTURBATION FOR 30 YEARS
 MEDICINE TO PREVENT CONCEPTION SUPPRESSED MASTURBATION
 MENSTRUAL DERANGED
 MENTAL EXCITEMENT
 NOVEL READING
 NYMPHOMANIA
 OPIUM HABIT
 OVER ACTION OF THE MIND
 OVER STUDY OF RELIGION
 OVER TAXING MENTAL POWERS
 PARENTS WERE COUSINS
 PERIODICAL FITS
 TOBACCO & MASTURBATION
 POLITICAL EXCITEMENT
 POLITICS
 RELIGIOUS ENTHUSIASM
 FEVER AND LOSS OF LAW SUIT
 FITS AND DESERTION OF HUSBAND
 ASTHMA
 BAD COMPANY
 BAD HABITS & POLITICAL EXCITEMENTSALVATION ARMY
 BAD WHISKEY
 BLOODY FLUX
 BRAIN FEVER
 BUSINESS NERVES
 CARBONIC ACID GAS
 CONGESTION OF BRAIN
 DEATH OF SONS IN WAR
 DECOYED INTO THE ARMY
 DERANGED MASTURBATION
 DESERTION BY HUSBAND
 DOMESTIC AFFLICTION
 DOMESTIC TROUBLE
 DROPSY
 EGOTISM
 EPILEPTIC FITS
 EXCESSIVE SEXUAL ABUSE
 EXCITEMENT AS OFFICER
 EXPOSURE AND HEREDITARY
 EXPOSURE AND QUACKERY
 EXPOSURE IN ARMY
 FEVER AND JEALOUSY
 FIGHTING FIRE
 SUPPRESSION OF MENSES
 THE WAR
 TIME OF LIFE
 UTERINE DERANGEMENT
 VENEREAL EXCESSES
 VICIOUS VICES
 WOMEN TROUBLE
 SUPERSTITION
 SHOOTING OF DAUGHTER
 SMALL POX
 SNUFF EATING FOR 2 YEARS
 SPINAL IRRITATION
 GATHERING IN THE HEAD
 GREEDINESS
 GUNSHOT WOUND
 HARD STUDy
 RUMOR OF HUSBAND MURDER
 SCARLATINA
 SEDUCTION & DISAPPOINTMENT
 SELF ABUSE
 SEXUAL ABUSE & STIMULANTS
 SEXUAL DERANGEMENT
 FALSE CONFINEMENT
 FEEBLENESS OF INTELLECT
 FELL FROM HORSE IN WAR
 FEMALE DISEASE
 DISSIPATION OF NERVES
<p><a href="http://laughoutloud-club.tumblr.com/post/170236009410/quite-the-reasons-for-admission" class="tumblr_blog">laughoutloud-club</a>:</p>

<blockquote><p>Quite The Reasons For Admission</p></blockquote>

<p><a href="http://laughoutloud-club.tumblr.com/post/170236009410/quite-the-reasons-for-admission" class="tumblr_blog">laughoutloud-club</a>...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...