🔥 | Latest

Being Alone, Beautiful, and Creepy: 17:17 1 13 hrs I often eat alone at a Wendy's that's just down the street from my house. A little less than a week ago, I noticed that they hired a new employee. She's a fair skinned woman who, for the sake of not violating a pending order of protection, we'll say is named Michelle. I was fond of her from the moment I first saw her. I immediately went home and scoured the internet to find out more information about her. I figured this way I'd be able to learn her interests and engage her in conversation regarding them l remember initially thinking to myself that it's a shame how name tags don't include last names. All I had to go on was her first name and location, yet thanks to Facebook's ability to search by city and state, I was able to find her after just a few hours. Once I did l realized I hit a goldmine; her phone number was visible to everyone, not just Facebook friends. Most women are scared to give out their number to a stranger because they don't think they're trustworthy, but if someone asked you out on a date after looking you up and learning your phone number without you having to tell them, you'd likely be far more trusting of that person since they already know your personal info. You'd have nothing to lose. That was my line of thinking, anyway. After obtaining her phone number I figured I'd try to do something romantic that would build up to me asking her out. I decided to use an app that would let me text her without revealing my actual number. The app allowed me to change my number at will O Write a comment... GF) )> 7 17:17 1 3 app allowed me to change my number at will, essentially making it unblockable, which I thought was a good idea since she might think it's just one of her friends messing with her and block it right away. This would grant me the ability to remain a complete enigma to her. "Once a day," I told myself. "Only text her once a day so it isn't creepy." Sadly, I was far too excited at the prospect of having my first girlfriend to stick to that. My first text to her was simply, "l saw that picture of your graduation you posted. You're beautiful." Later that day while I was sitting in the Wendy's parking lot I sent her another text that said, "l can see you right now. One day you'll see me, too." Before I knew it I had texted her over three hundred times in just a few days She never once responded to any of them. Still, not all messages contained text, some were just pictures of her that l took while she was at work to let her know that I was actually there Some of you may have noticed that I wasn't online at all yesterday. There is good reason for that. Yesterday was the day that I met her in person and tried to ask her out. It didn't go as planned. I walked up to Michelle while she was at the counter and told her that I'm her admirer. Her cheerful expression changed as she suddenly started shouting, "This is the guy! Marco, this is the guy!" Marco is her manager. He jumped from behind the counter and grabbed me while instructing her to call the police. I bit his arm hard enough to draw blood, but he did not release me O Write a comment... GF) )> 7 17:17 1 13 hrs while instructing her to call the police. I bit his arm hard enough to draw blood, but he did not release me until police arrivedd The police said that the detainment was lawful, which meant that I was to be charged with battery for biting the manager in addition to stalking. This amounts to almost $500 in fines. Thankfully, father told me he'd take care of it since I'm currently unemployed. The police also told me that she's filing for an order of protection, so l can't return to that specific Wendy's. Father told me to keep my chin up and to remember that some women just aren't worth it. He said that If she thinks having a guy flatter her and think about her all the time is something to call the police over, then she must be "one of those nutty feminists." After spending some time thinking about it, I realized that he's right. Sometimes you just have to remind yourself that it's not you, it's them O Write a comment... GIF 7 The creepiest Neckbeard I've seen in a long time, him and his dad blame rejection on feminism
Being Alone, Beautiful, and Creepy: 17:17 1
 13 hrs
 I often eat alone at a Wendy's that's just down the
 street from my house. A little less than a week ago, I
 noticed that they hired a new employee. She's a fair
 skinned woman who, for the sake of not violating a
 pending order of protection, we'll say is named
 Michelle. I was fond of her from the moment I first saw
 her. I immediately went home and scoured the
 internet to find out more information about her. I
 figured this way I'd be able to learn her interests and
 engage her in conversation regarding them
 l remember initially thinking to myself that it's a shame
 how name tags don't include last names. All I had to
 go on was her first name and location, yet thanks to
 Facebook's ability to search by city and state, I was
 able to find her after just a few hours. Once I did l
 realized I hit a goldmine; her phone number was
 visible to everyone, not just Facebook friends. Most
 women are scared to give out their number to a
 stranger because they don't think they're trustworthy,
 but if someone asked you out on a date after looking
 you up and learning your phone number without you
 having to tell them, you'd likely be far more trusting of
 that person since they already know your personal
 info. You'd have nothing to lose. That was my line of
 thinking, anyway.
 After obtaining her phone number I figured I'd try to
 do something romantic that would build up to me
 asking her out. I decided to use an app that would let
 me text her without revealing my actual number. The
 app allowed me to change my number at will
 O
 Write a comment...
 GF) )>
 7

 17:17 1
 3
 app allowed me to change my number at will,
 essentially making it unblockable, which I thought was
 a good idea since she might think it's just one of her
 friends messing with her and block it right away. This
 would grant me the ability to remain a complete
 enigma to her. "Once a day," I told myself. "Only text
 her once a day so it isn't creepy." Sadly, I was far too
 excited at the prospect of having my first girlfriend to
 stick to that.
 My first text to her was simply, "l saw that picture of
 your graduation you posted. You're beautiful." Later
 that day while I was sitting in the Wendy's parking lot I
 sent her another text that said, "l can see you right
 now. One day you'll see me, too." Before I knew it I had
 texted her over three hundred times in just a few days
 She never once responded to any of them. Still, not all
 messages contained text, some were just pictures of
 her that l took while she was at work to let her know
 that I was actually there
 Some of you may have noticed that I wasn't online at
 all yesterday. There is good reason for that. Yesterday
 was the day that I met her in person and tried to ask
 her out. It didn't go as planned. I walked up to
 Michelle while she was at the counter and told her
 that I'm her admirer. Her cheerful expression changed
 as she suddenly started shouting, "This is the guy!
 Marco, this is the guy!" Marco is her manager. He
 jumped from behind the counter and grabbed me
 while instructing her to call the police. I bit his arm
 hard enough to draw blood, but he did not release me
 O
 Write a comment...
 GF) )>
 7

 17:17 1
 13 hrs
 while instructing her to call the police. I bit his arm
 hard enough to draw blood, but he did not release me
 until police arrivedd
 The police said that the detainment was lawful, which
 meant that I was to be charged with battery for biting
 the manager in addition to stalking. This amounts to
 almost $500 in fines. Thankfully, father told me he'd
 take care of it since I'm currently unemployed. The
 police also told me that she's filing for an order of
 protection, so l can't return to that specific Wendy's.
 Father told me to keep my chin up and to remember
 that some women just aren't worth it. He said that If
 she thinks having a guy flatter her and think about her
 all the time is something to call the police over, then
 she must be "one of those nutty feminists." After
 spending some time thinking about it, I realized that
 he's right. Sometimes you just have to remind yourself
 that it's not you, it's them
 O
 Write a comment...
 GIF
 7
The creepiest Neckbeard I've seen in a long time, him and his dad blame rejection on feminism

The creepiest Neckbeard I've seen in a long time, him and his dad blame rejection on feminism

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Apparently, Bless Up, and Boobies: MORE PEANUT BUTTER! Shout to u pretty older ladies that keep the bra on when we smash bc u self conscious and afraid the young buck that u with gonna be judgy about them girls being stretch marky and hangy when that bra pop off y’all cute. Bashful. Y’all adorable. BUT LISTEN HERE COT DAMMIT IF U DONT LET THEM GIRLS COME OUT AND PLAY WE GON HAVE ISSUES I NEED THE LIGHTS ON SHINING ON EVERY MINOR DETAIL AND ‘IMPERFECTION’ (personally I call them ‘perfections’. Butt dimples? Cellulite? Stretch marks? U perfect to me, aint a cot damn thing ‘im’ about it 🤗). U 42 NOT 22 YA BOOBIES NOT SUPPOSE TO BE UPRIGHT AND FIRM STARING OFF IN SEPARATE DIRECTIONS LIKE FETTY WAP’S EYES THEY SUPPOSE TO FLOP DOWN A LIL BIT AND THAT’S PART OF THE BEAUTY OF THINE SHAPE WHY U EMBARRASSED OF SOMETHING CUTE IN THE FIRST PLACE! THAT’S WHY I DON’T BE WEARING PANTS OR BOXERS I WALK AROUND NEKKY BECAUSE I’M CUTE, BIH! MY PP HANDSOME! FVCK U THOUGHT! EVEN WHEN THE ROOM 67.5 DEGREES AND MR. PEEPATOUS (he Greek apparently - to my knowledge I aint Greek but he Greek lmao “OPA!!!”) HATH PARTLY RECEDED INTO MY BODY FOR WARMTH AND COMFORT AW HELL NAH! HE STILL HANDSOME! LET THEM GIRLS OUT, WOMAN! SENDING SELFIES ON THE BED LAYING FLAT ARMS UP APPLYING EIGHT FILTERS CONTORTING YA ENTIRE COT DAMN EXISTENCE TO GET THEM GIRLS LOOKING YOUNG AND PERKY I AINT ASK FOR THAT! LEMME SEE *YOU* COT DAMMIT! LIKE CREEPY HOMEBOY MR HOT SPOT BE SAYING: “YEAH! I *LIKE* **THAT**!!” YA GET ME! BLESS UP 😍❤️😂😂😂 (Pic: Reddit u-tfro9)
Apparently, Bless Up, and Boobies: MORE PEANUT BUTTER!
Shout to u pretty older ladies that keep the bra on when we smash bc u self conscious and afraid the young buck that u with gonna be judgy about them girls being stretch marky and hangy when that bra pop off y’all cute. Bashful. Y’all adorable. BUT LISTEN HERE COT DAMMIT IF U DONT LET THEM GIRLS COME OUT AND PLAY WE GON HAVE ISSUES I NEED THE LIGHTS ON SHINING ON EVERY MINOR DETAIL AND ‘IMPERFECTION’ (personally I call them ‘perfections’. Butt dimples? Cellulite? Stretch marks? U perfect to me, aint a cot damn thing ‘im’ about it 🤗). U 42 NOT 22 YA BOOBIES NOT SUPPOSE TO BE UPRIGHT AND FIRM STARING OFF IN SEPARATE DIRECTIONS LIKE FETTY WAP’S EYES THEY SUPPOSE TO FLOP DOWN A LIL BIT AND THAT’S PART OF THE BEAUTY OF THINE SHAPE WHY U EMBARRASSED OF SOMETHING CUTE IN THE FIRST PLACE! THAT’S WHY I DON’T BE WEARING PANTS OR BOXERS I WALK AROUND NEKKY BECAUSE I’M CUTE, BIH! MY PP HANDSOME! FVCK U THOUGHT! EVEN WHEN THE ROOM 67.5 DEGREES AND MR. PEEPATOUS (he Greek apparently - to my knowledge I aint Greek but he Greek lmao “OPA!!!”) HATH PARTLY RECEDED INTO MY BODY FOR WARMTH AND COMFORT AW HELL NAH! HE STILL HANDSOME! LET THEM GIRLS OUT, WOMAN! SENDING SELFIES ON THE BED LAYING FLAT ARMS UP APPLYING EIGHT FILTERS CONTORTING YA ENTIRE COT DAMN EXISTENCE TO GET THEM GIRLS LOOKING YOUNG AND PERKY I AINT ASK FOR THAT! LEMME SEE *YOU* COT DAMMIT! LIKE CREEPY HOMEBOY MR HOT SPOT BE SAYING: “YEAH! I *LIKE* **THAT**!!” YA GET ME! BLESS UP 😍❤️😂😂😂 (Pic: Reddit u-tfro9)

Shout to u pretty older ladies that keep the bra on when we smash bc u self conscious and afraid the young buck that u with gonna be judgy a...

Creepy, Definitely, and Desperate: RATE THIS CHAT Today, 3:10 PM Neckbeardy?? What does women's issues have to do with the fact that if ur not hot u get called a creep for wanting to hang out Today, 3:58 PM it depends how you go about asking. i know literally no one who has beern called a creep for asking someone to hang out while looking average. if women are calling you a creep every time you ask them to hang... the problem isn't with women, it's with you. evaluate how you approach women. So my problem is that i shouldnt text hey whats up?" Or "hey we should So my problem is that i shouldnt text, hey whats up?" Or "hey we should hang out sometime" because its creepy??? But a friend of mine just sends a dick pic or whips it out and gets the girl and thats not creepy?? Must be the font style im using right? the thing is... yeah, some women are willing to hook up over a dick pic. women aren't all the same. lumping the whole group into "women think average guys are creeps but bang hot guys easily" is wildly inaccurate of most women. they're not some hivemind, they're individual people. sure, you can say "hey we should hang", but if you act pushy/desperate, make sexual comments, ignore boundaries, STEREOTYPE ALL WOMEN, etc they're gonna think you're a creep. like i said, step back and evaluate your behavior. make sure you're not doing anything that makes women uncomfortable. Like texting them lol ur not very smart dude i know you meant texting. all of the things i mentioned can be done over text. if you think they can't, then it's not me who's stupid... based on this conversation so far, yeah, i can definitely see why women don't want to hang out with you. you refuse to see them as anything more than a stereotype, you insult people who try to give you constructive feedback, you don't listen, and you seem to only think about yourself. Ur right bro. I should use different tone and inflections via text messages... especially when saying whats up... its gotta be selfish to ask what a girl is doing or how shes feeling feeling. I should just send a dick pic lol yeah, you're completely not getting it. well, i tried. there's no point in talking to a brick wall, so see ya. Whats there to get? I should change the way i say whats up?? like talking to a brick wall (OP from my last post messaged me)
Creepy, Definitely, and Desperate: RATE THIS CHAT
 Today, 3:10 PM
 Neckbeardy??
 What does women's issues have to do
 with the fact that if ur not hot u get
 called a creep for wanting to hang out
 Today, 3:58 PM
 it depends how you go about asking. i
 know literally no one who has beern
 called a creep for asking someone to
 hang out while looking average.
 if women are calling you a creep every
 time you ask them to hang... the
 problem isn't with women, it's with you.
 evaluate how you approach women.
 So my problem is that i shouldnt text
 hey whats up?" Or "hey we should

 So my problem is that i shouldnt text,
 hey whats up?" Or "hey we should
 hang out sometime" because its
 creepy??? But a friend of mine just
 sends a dick pic or whips it out and
 gets the girl and thats not creepy??
 Must be the font style im using right?
 the thing is... yeah, some women are
 willing to hook up over a dick pic.
 women aren't all the same. lumping
 the whole group into "women think
 average guys are creeps but bang hot
 guys easily" is wildly inaccurate of
 most women. they're not some
 hivemind, they're individual people.
 sure, you can say "hey we should
 hang", but if you act pushy/desperate,
 make sexual comments, ignore
 boundaries, STEREOTYPE ALL
 WOMEN, etc they're gonna think you're
 a creep. like i said, step back and
 evaluate your behavior. make sure
 you're not doing anything that makes
 women uncomfortable.

 Like texting them lol ur not very smart
 dude i know you meant texting. all of
 the things i mentioned can be done
 over text.
 if you think they can't, then it's not me
 who's stupid...
 based on this conversation so far, yeah,
 i can definitely see why women don't
 want to hang out with you. you refuse
 to see them as anything more than a
 stereotype, you insult people who try to
 give you constructive feedback, you
 don't listen, and you seem to only think
 about yourself.
 Ur right bro. I should use different
 tone and inflections via text
 messages... especially when saying
 whats up... its gotta be selfish to ask
 what a girl is doing or how shes
 feeling

 feeling.
 I should just send a dick pic lol
 yeah, you're completely not getting it.
 well, i tried. there's no point in talking
 to a brick wall, so see ya.
 Whats there to get? I should change
 the way i say whats up??
like talking to a brick wall (OP from my last post messaged me)

like talking to a brick wall (OP from my last post messaged me)

Chill, College, and Creepy: u/a_slinky ld imgur This is Iggy. He is everything that is good in this world @DrSmashlove LET’S KEEP IT 600 HAVE YALL EVER MET SOMEONE NAMED STEPHANIE AT A WORK FUNCTION AND THEN U GOOGLE STEPHANIE AND U ELEVENTEEN PAGES DEEP ON STEPHANIE’s GOOGLE RESULTS AND U GET TO STEPHANIE’s WEBSITE ON “theknot” AND U JUST LIKE “wow they posed in front of the Bucks stadium wearing matching Bucks jerseys LMAO” AND U LOOKING THRU THE GROOMSMEN FOR ROGER, THE GROOM, AND U SCROLLING THRU “Todd: Frat Brother”, “Jeff: The Troublemaker (Editor’s Note: Jeff is always overweight with a baby face and is wearing a bow tie lmao)”, and u get to “Kelly, the Groomswoman” AND U JUST LIKE “wow I wonder if Stephanie low key hates Kelly and wonders if once, just once, Kelly got extra drunky at college at smashed Roger but they never smashed again but Roger still low key loves her and thinks about her lol wow that’s wild Kelly u wild, started at a bar crawl now u here LMAO LMAO” SO U GOOGLE “Kelly Patterson” AND FIND OUT THAT SHE ACTUALLY HAS A BOYFRIEND NAMED RICK AND U WONDER IF THE BOYFRIEND IS A LITTLE TIGHT THAT MAYBE KELLY SMASHED ROGER TOO AND THEN IT DAWNS ON U. IT DAWNS ON U, BRUV. RIGHT THEN AND THERE. U HAVE GOOGLE STALKED THIS WEB OF FRIENDS INTO THE Nth MOTHERFVCKING DIMENSION BRUV. IT’S NOWHERE TO TAKE IT NOW. WHAT’S THE LIMIT? HAS SCIENCE GONE TOO FAR? AND THEN U FEEL LOW KEY SAD AND IT DAWNS ON U THAT U NEED TO GET RIGHT WITH GOD BUT U DECIDE TO SEE WHO KELLY IS FOLLOWING AND LOW AND BEHOLD SHE FOLLOWS SMASH (and u wondering: do she follow for the pups? The captions? Both? 😜) SO REALLY U AIN’T STALKING AT ALL U JUST GAZING DOWN AT YO FOLLOWERS FROM UP HIGH ON YO LONELY INSTAGRAM PERCH AND NOW INSTEAD OF FEELING CREEPY U CONSIDERING DM’ing HER LIKE “aye so did u smash Roger? 😏Lmao 🤓” BUT THEN U REMIND YOURSELF TO CHILL HAPPY FRIDAY 🤗😂😂😂
Chill, College, and Creepy: u/a_slinky ld imgur
 This is Iggy. He is everything that is good in
 this world
 @DrSmashlove
LET’S KEEP IT 600 HAVE YALL EVER MET SOMEONE NAMED STEPHANIE AT A WORK FUNCTION AND THEN U GOOGLE STEPHANIE AND U ELEVENTEEN PAGES DEEP ON STEPHANIE’s GOOGLE RESULTS AND U GET TO STEPHANIE’s WEBSITE ON “theknot” AND U JUST LIKE “wow they posed in front of the Bucks stadium wearing matching Bucks jerseys LMAO” AND U LOOKING THRU THE GROOMSMEN FOR ROGER, THE GROOM, AND U SCROLLING THRU “Todd: Frat Brother”, “Jeff: The Troublemaker (Editor’s Note: Jeff is always overweight with a baby face and is wearing a bow tie lmao)”, and u get to “Kelly, the Groomswoman” AND U JUST LIKE “wow I wonder if Stephanie low key hates Kelly and wonders if once, just once, Kelly got extra drunky at college at smashed Roger but they never smashed again but Roger still low key loves her and thinks about her lol wow that’s wild Kelly u wild, started at a bar crawl now u here LMAO LMAO” SO U GOOGLE “Kelly Patterson” AND FIND OUT THAT SHE ACTUALLY HAS A BOYFRIEND NAMED RICK AND U WONDER IF THE BOYFRIEND IS A LITTLE TIGHT THAT MAYBE KELLY SMASHED ROGER TOO AND THEN IT DAWNS ON U. IT DAWNS ON U, BRUV. RIGHT THEN AND THERE. U HAVE GOOGLE STALKED THIS WEB OF FRIENDS INTO THE Nth MOTHERFVCKING DIMENSION BRUV. IT’S NOWHERE TO TAKE IT NOW. WHAT’S THE LIMIT? HAS SCIENCE GONE TOO FAR? AND THEN U FEEL LOW KEY SAD AND IT DAWNS ON U THAT U NEED TO GET RIGHT WITH GOD BUT U DECIDE TO SEE WHO KELLY IS FOLLOWING AND LOW AND BEHOLD SHE FOLLOWS SMASH (and u wondering: do she follow for the pups? The captions? Both? 😜) SO REALLY U AIN’T STALKING AT ALL U JUST GAZING DOWN AT YO FOLLOWERS FROM UP HIGH ON YO LONELY INSTAGRAM PERCH AND NOW INSTEAD OF FEELING CREEPY U CONSIDERING DM’ing HER LIKE “aye so did u smash Roger? 😏Lmao 🤓” BUT THEN U REMIND YOURSELF TO CHILL HAPPY FRIDAY 🤗😂😂😂

LET’S KEEP IT 600 HAVE YALL EVER MET SOMEONE NAMED STEPHANIE AT A WORK FUNCTION AND THEN U GOOGLE STEPHANIE AND U ELEVENTEEN PAGES DEEP ON S...