🔥 | Latest

Beautiful, Brains, and Goals: IONCLE SAINT LAUREN ONLY THE WEAK GIVE UP Our brains are wired to giving up easily, it’s normal (but not all right). 🤔 Human beings are believed to act upon the “Pleasure Principle”, the instant gratification… Instant gratification is the desire to experience pleasure or fulfillment without delay or deferment. Basically, it’s when you want it; and you want it now. (just in case your wanted to know what it meant.) Yes, so once in a while, wanting to give up is normal. But giving up is not okay.☝️ - ✔️Giving up makes you lose more things than you can imagine. Instant success is a myth, always. Many successful people failed hundreds of times, if they chose to give up instead of working harder to reach their goals, they would never succeed. ✔️Picture in your mind the ultimate result. Keep in your mind the picture of the end result. A visualization of what you want to accomplish will keep you moving forward. I mean, seriously, you don’t want to stop partway through. The feeling of being a quitter isn’t pleasant. You are a winner! ✔️Remember why you started and how much you really wanted it. Think back to the moment that this project, goal, or concept was conceived. Remember the joy and thrill of the adventure ahead? At the beginning, you had a goal in mind; a beautiful picture etched in your mind of the finished task. Beginning was simple; carrying through has become difficult. Going back to the beginning brings into focus the purpose of your endeavor. The memory of anticipation of the job accomplished is stirred up again when you begin to contemplate the reason you began in the first place. Breathe in deep and recall your purpose. - Don’t give up! - givingup success millionairementor
Beautiful, Brains, and Goals: IONCLE
 SAINT LAUREN
 ONLY THE WEAK
 GIVE UP
Our brains are wired to giving up easily, it’s normal (but not all right). 🤔 Human beings are believed to act upon the “Pleasure Principle”, the instant gratification… Instant gratification is the desire to experience pleasure or fulfillment without delay or deferment. Basically, it’s when you want it; and you want it now. (just in case your wanted to know what it meant.) Yes, so once in a while, wanting to give up is normal. But giving up is not okay.☝️ - ✔️Giving up makes you lose more things than you can imagine. Instant success is a myth, always. Many successful people failed hundreds of times, if they chose to give up instead of working harder to reach their goals, they would never succeed. ✔️Picture in your mind the ultimate result. Keep in your mind the picture of the end result. A visualization of what you want to accomplish will keep you moving forward. I mean, seriously, you don’t want to stop partway through. The feeling of being a quitter isn’t pleasant. You are a winner! ✔️Remember why you started and how much you really wanted it. Think back to the moment that this project, goal, or concept was conceived. Remember the joy and thrill of the adventure ahead? At the beginning, you had a goal in mind; a beautiful picture etched in your mind of the finished task. Beginning was simple; carrying through has become difficult. Going back to the beginning brings into focus the purpose of your endeavor. The memory of anticipation of the job accomplished is stirred up again when you begin to contemplate the reason you began in the first place. Breathe in deep and recall your purpose. - Don’t give up! - givingup success millionairementor

Our brains are wired to giving up easily, it’s normal (but not all right). 🤔 Human beings are believed to act upon the “Pleasure Principle”,...

Clothes, Ironic, and Life: Why do l understand this G.O.A.T. @thatudiboy There is always that one innocent spoon in every home that you just dislike for no reason Life Tips: Making Mornings Easier If you’re anything like a normal human being, you have days where you’re just totally off. You sleep through your alarm and suddenly the whole day is thrown off. Below are some of my tips for making those off days or even just everyday a bit easier. 1. Pack everything the night before This seems like a no-brainer, I tell myself to do this often and when I don’t follow through, I wish I had. Set aside your outfit (down to the undergarments-seriously) If you workout (if you don’t-you should try to) set aside your workout clothes and shoes. You’ll have less excuses to not get started. Pack your lunch-don’t forget to fill up your water bottle Pack your work bag-backpack-purse with everything you will need to make it through the day. 2. Be prepared It only takes a bit of time to get yourself prepared for just about anything. Think about your essentials, things you wouldn’t want to be stuck without and things you always find yourself needing. You can either add these items to your daily bag or stash them in your car-desk-locker. 3. Don’t over complicate things If you know you are going to have a stressful week-plan ahead. Stick to the basics 4. Make lists Duh. Take a few minutes to get it together, list out things you’ve forgotten (groceries, errands, etc) and prioritize. It will seem much more simple when everything is laid out in front of you and not jumbled up in your brain. 5. To remember things: keep them close to you I’m horrible at taking off my makeup. I made a nasty habit of sleeping in makeup and only washing my face in the shower. To tackle this, I’ve left my makeup remover right by my toothbrush. This way when I brush my teeth at night, it’s easy to pull out a wipe and get rid of my raccoon eyes. I’ve also added night cream and Chapstick on my bedside table. Taking care of your skin is important! Lips too! 6. Set reminders Use the phone you are undoubtedly attached to. Set yourself alarms and reminders if you simply can’t be bothered to get it together. A little bit of preparation, planning and being easier on yourself can go a long way towards making every day better. billsimportantposts
Clothes, Ironic, and Life: Why do l understand this
 G.O.A.T. @thatudiboy
 There is always that one innocent spoon in
 every home that you just dislike for no
 reason
Life Tips: Making Mornings Easier If you’re anything like a normal human being, you have days where you’re just totally off. You sleep through your alarm and suddenly the whole day is thrown off. Below are some of my tips for making those off days or even just everyday a bit easier. 1. Pack everything the night before This seems like a no-brainer, I tell myself to do this often and when I don’t follow through, I wish I had. Set aside your outfit (down to the undergarments-seriously) If you workout (if you don’t-you should try to) set aside your workout clothes and shoes. You’ll have less excuses to not get started. Pack your lunch-don’t forget to fill up your water bottle Pack your work bag-backpack-purse with everything you will need to make it through the day. 2. Be prepared It only takes a bit of time to get yourself prepared for just about anything. Think about your essentials, things you wouldn’t want to be stuck without and things you always find yourself needing. You can either add these items to your daily bag or stash them in your car-desk-locker. 3. Don’t over complicate things If you know you are going to have a stressful week-plan ahead. Stick to the basics 4. Make lists Duh. Take a few minutes to get it together, list out things you’ve forgotten (groceries, errands, etc) and prioritize. It will seem much more simple when everything is laid out in front of you and not jumbled up in your brain. 5. To remember things: keep them close to you I’m horrible at taking off my makeup. I made a nasty habit of sleeping in makeup and only washing my face in the shower. To tackle this, I’ve left my makeup remover right by my toothbrush. This way when I brush my teeth at night, it’s easy to pull out a wipe and get rid of my raccoon eyes. I’ve also added night cream and Chapstick on my bedside table. Taking care of your skin is important! Lips too! 6. Set reminders Use the phone you are undoubtedly attached to. Set yourself alarms and reminders if you simply can’t be bothered to get it together. A little bit of preparation, planning and being easier on yourself can go a long way towards making every day better. billsimportantposts

Life Tips: Making Mornings Easier If you’re anything like a normal human being, you have days where you’re just totally off. You sleep throu...

Confidence, Future, and Goals: YOU MUST REMAIN A STUDENT OF LIFE. Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness. So how can you be the best possible student of life so that it builds on your happiness levels? Here’s what has worked for me so far. (Yes, your boy millmentor will share his secrets) - 7 ways how being a “student” of life improves your happiness👇 - ✔️Be open minded. An open, positive mindset improves your overall happiness. ✔️Learn something new everyday. Cherish all the different aspects of life that exist. Life is about learning. ✔️Do something you’re afraid of. Courage gives you a real high and positive confidence for the future. ✔️Stay hungry for MORE. Set ambitious goals. You’re happiest when you’re growing. ✔️Take things lightly. When you take things less seriously, you’re much more bound to have fun. ✔️Always remain curious. Always. You’ll find you’ll discover a whole new, exciting world behind curiosity. ✔️Reflect on what’s happening in your life. Knowing how you feel helps you make future decisions that will boost your happiness. - I challenge you to take action on these now and become a happy human being! - Are you going to use these tips? Comment below with your feedback!👇 - life happiness millionairementor
Confidence, Future, and Goals: YOU MUST REMAIN
 A STUDENT OF LIFE.
Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness. So how can you be the best possible student of life so that it builds on your happiness levels? Here’s what has worked for me so far. (Yes, your boy millmentor will share his secrets) - 7 ways how being a “student” of life improves your happiness👇 - ✔️Be open minded. An open, positive mindset improves your overall happiness. ✔️Learn something new everyday. Cherish all the different aspects of life that exist. Life is about learning. ✔️Do something you’re afraid of. Courage gives you a real high and positive confidence for the future. ✔️Stay hungry for MORE. Set ambitious goals. You’re happiest when you’re growing. ✔️Take things lightly. When you take things less seriously, you’re much more bound to have fun. ✔️Always remain curious. Always. You’ll find you’ll discover a whole new, exciting world behind curiosity. ✔️Reflect on what’s happening in your life. Knowing how you feel helps you make future decisions that will boost your happiness. - I challenge you to take action on these now and become a happy human being! - Are you going to use these tips? Comment below with your feedback!👇 - life happiness millionairementor

Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...