◀
Share
Related
š„ | Latest
Arguing, Books, and Disney: N
111 44% A 1 :56 AM
Pm.Facebook,com
kuzco's poison
@NathanZed
The Emperors NewW
Groove is the most
underrated disney
movie of all time
5:43 PM 25 Mar 2018
Dids
The poison. The poison for Kuzco, the poison
chosen especially to kill Kuzco, Kuzco's poisorn
Disnerds
Timeline Photos Mar 28 at 10:26am
BackForward Home Bookmarks Tabs
Š°Ń
[ ]
ft. .dill 38%
1 :46 AM
Laura Beth C
No, there's other movies I would list
as most underrated. Most people I
know love Emperor's New Groove.
Movies I would give more credit to
that don't get enough are:
Fantasia. It's not that it's unheard of
or doesn't get marketing, but how
often do you hear people say it's their
favorite? Amongst artists and
animators, it recieves high praise but
not amongst the general populace.
And outside of Sorcerer's apprentice
do you see merchandise? It is there
but not like other films, and it's often
super expensive
Black Cauldron has an underground
following but other than hardcore
Disney fans, who even knows about
the film? And while it's true that the
books ot's based off are way better,
and the pacing and storytelling in the
movie tend to fall flat, I would argue
that it is again, visually, one of the
best animated Disney movies easilly
It's gorgeously animated. Despite its
faults and flaws, I think it does want
to be a good movie
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
this movie d nt get more love
Atlantis is visually interesting, lots of
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
why this movie doesn't get more love
Atlantis is visually interesting, lots of
fun, but does suffer from pacing
issues. Still, I think it's enjoyable and
has a cast of interesting characters
Not to mention Kida is a cool
princesS.
Treasure Planet is a fun movie and an
interesting retelling of a classic.
Granted, I think the story is a bit
predictable (being a classic novel set
aside) and I think Disney movies were
getting a bit formulaic at the time in
how they were being served, and in
flavor. So I think that's why movies at
this time were not doing well in
general. But I think this movie was
better than it was given credit at the
time
Brother Bear suffers many of the
same issues as Treasure Planet in the
timing it came out, and being
formulaic in flavor. So it didn't get
much love. Surprisingly, when I finally
got around to watching it, I thought it
was much better than expected
Disney probably tried to market the
Mooses a bit too hard
So yeah, I would hose movies are
waaay more underappreciated. Some
N >
111 38% A 1 :46 AM
So yeah, I would say those movies are
waaay more underappreciated. Some
might argue Sword In The Stone
Robin Hood, Fox and the Hound,
Great Mouse Detective, Oliver and
Company, Hunchback, Meet The
Robinsons, and Bolt as well
And before anybody says it, Home On
The Range was a terrible movie that
dealt the final blow to traditional
animated movies in the US and I'll
never forgive it. It's plot was
quintessentially formulaic. The
characters are crude, mean spirited
annoying, or a combination of all
three. The original idea that the
animators had about ghost riders and
a fearful cowboy was SO00O much
more interesting and appealing. It
was pure brain worm infesting
madness that drove them to take the
film in such a dumb boring direction
The only interesting qualities it has is
Alameda Slim could have potentially
been an interesting villian but his
potential is wasted on this movie. The
movie has moments where it is
ALMOST charming and then is
followed up with a dumb burp or fart
joke or something crude. Sorry to
anybody that likes the movie. It's ok if
you like it and that's vour choice but it
doesn't make the film a good movie. 12
on Wed Like Re More
Thomas John Allen replied 4 replies
i make 1 tweet about The Emperors New Groove and Laura went wild https://t.co/XCG8P328Tc
![Arguing, Books, and Disney: N
111 44% A 1 :56 AM
Pm.Facebook,com
kuzco's poison
@NathanZed
The Emperors NewW
Groove is the most
underrated disney
movie of all time
5:43 PM 25 Mar 2018
Dids
The poison. The poison for Kuzco, the poison
chosen especially to kill Kuzco, Kuzco's poisorn
Disnerds
Timeline Photos Mar 28 at 10:26am
BackForward Home Bookmarks Tabs
Š°Ń
[ ]
ft. .dill 38%
1 :46 AM
Laura Beth C
No, there's other movies I would list
as most underrated. Most people I
know love Emperor's New Groove.
Movies I would give more credit to
that don't get enough are:
Fantasia. It's not that it's unheard of
or doesn't get marketing, but how
often do you hear people say it's their
favorite? Amongst artists and
animators, it recieves high praise but
not amongst the general populace.
And outside of Sorcerer's apprentice
do you see merchandise? It is there
but not like other films, and it's often
super expensive
Black Cauldron has an underground
following but other than hardcore
Disney fans, who even knows about
the film? And while it's true that the
books ot's based off are way better,
and the pacing and storytelling in the
movie tend to fall flat, I would argue
that it is again, visually, one of the
best animated Disney movies easilly
It's gorgeously animated. Despite its
faults and flaws, I think it does want
to be a good movie
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
this movie d nt get more love
Atlantis is visually interesting, lots of
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
why this movie doesn't get more love
Atlantis is visually interesting, lots of
fun, but does suffer from pacing
issues. Still, I think it's enjoyable and
has a cast of interesting characters
Not to mention Kida is a cool
princesS.
Treasure Planet is a fun movie and an
interesting retelling of a classic.
Granted, I think the story is a bit
predictable (being a classic novel set
aside) and I think Disney movies were
getting a bit formulaic at the time in
how they were being served, and in
flavor. So I think that's why movies at
this time were not doing well in
general. But I think this movie was
better than it was given credit at the
time
Brother Bear suffers many of the
same issues as Treasure Planet in the
timing it came out, and being
formulaic in flavor. So it didn't get
much love. Surprisingly, when I finally
got around to watching it, I thought it
was much better than expected
Disney probably tried to market the
Mooses a bit too hard
So yeah, I would hose movies are
waaay more underappreciated. Some
N >
111 38% A 1 :46 AM
So yeah, I would say those movies are
waaay more underappreciated. Some
might argue Sword In The Stone
Robin Hood, Fox and the Hound,
Great Mouse Detective, Oliver and
Company, Hunchback, Meet The
Robinsons, and Bolt as well
And before anybody says it, Home On
The Range was a terrible movie that
dealt the final blow to traditional
animated movies in the US and I'll
never forgive it. It's plot was
quintessentially formulaic. The
characters are crude, mean spirited
annoying, or a combination of all
three. The original idea that the
animators had about ghost riders and
a fearful cowboy was SO00O much
more interesting and appealing. It
was pure brain worm infesting
madness that drove them to take the
film in such a dumb boring direction
The only interesting qualities it has is
Alameda Slim could have potentially
been an interesting villian but his
potential is wasted on this movie. The
movie has moments where it is
ALMOST charming and then is
followed up with a dumb burp or fart
joke or something crude. Sorry to
anybody that likes the movie. It's ok if
you like it and that's vour choice but it
doesn't make the film a good movie. 12
on Wed Like Re More
Thomas John Allen replied 4 replies
i make 1 tweet about The Emperors New Groove and Laura went wild https://t.co/XCG8P328Tc](https://pics.onsizzle.com/n-111-44-a-1-56-am-pm-facebook-com-kuzcos-poison-31978503.png)
![Arguing, Books, and Disney: N
111 44% A 1 :56 AM
Pm.Facebook,com
kuzco's poison
@NathanZed
The Emperors NewW
Groove is the most
underrated disney
movie of all time
5:43 PM 25 Mar 2018
Dids
The poison. The poison for Kuzco, the poison
chosen especially to kill Kuzco, Kuzco's poisorn
Disnerds
Timeline Photos Mar 28 at 10:26am
BackForward Home Bookmarks Tabs
Š°Ń
[ ]
ft. .dill 38%
1 :46 AM
Laura Beth C
No, there's other movies I would list
as most underrated. Most people I
know love Emperor's New Groove.
Movies I would give more credit to
that don't get enough are:
Fantasia. It's not that it's unheard of
or doesn't get marketing, but how
often do you hear people say it's their
favorite? Amongst artists and
animators, it recieves high praise but
not amongst the general populace.
And outside of Sorcerer's apprentice
do you see merchandise? It is there
but not like other films, and it's often
super expensive
Black Cauldron has an underground
following but other than hardcore
Disney fans, who even knows about
the film? And while it's true that the
books ot's based off are way better,
and the pacing and storytelling in the
movie tend to fall flat, I would argue
that it is again, visually, one of the
best animated Disney movies easilly
It's gorgeously animated. Despite its
faults and flaws, I think it does want
to be a good movie
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
this movie d nt get more love
Atlantis is visually interesting, lots of
Rescuers Down Under is a great
movie everyone seems to just forget
about for some reason. I don't know
why this movie doesn't get more love
Atlantis is visually interesting, lots of
fun, but does suffer from pacing
issues. Still, I think it's enjoyable and
has a cast of interesting characters
Not to mention Kida is a cool
princesS.
Treasure Planet is a fun movie and an
interesting retelling of a classic.
Granted, I think the story is a bit
predictable (being a classic novel set
aside) and I think Disney movies were
getting a bit formulaic at the time in
how they were being served, and in
flavor. So I think that's why movies at
this time were not doing well in
general. But I think this movie was
better than it was given credit at the
time
Brother Bear suffers many of the
same issues as Treasure Planet in the
timing it came out, and being
formulaic in flavor. So it didn't get
much love. Surprisingly, when I finally
got around to watching it, I thought it
was much better than expected
Disney probably tried to market the
Mooses a bit too hard
So yeah, I would hose movies are
waaay more underappreciated. Some
N >
111 38% A 1 :46 AM
So yeah, I would say those movies are
waaay more underappreciated. Some
might argue Sword In The Stone
Robin Hood, Fox and the Hound,
Great Mouse Detective, Oliver and
Company, Hunchback, Meet The
Robinsons, and Bolt as well
And before anybody says it, Home On
The Range was a terrible movie that
dealt the final blow to traditional
animated movies in the US and I'll
never forgive it. It's plot was
quintessentially formulaic. The
characters are crude, mean spirited
annoying, or a combination of all
three. The original idea that the
animators had about ghost riders and
a fearful cowboy was SO00O much
more interesting and appealing. It
was pure brain worm infesting
madness that drove them to take the
film in such a dumb boring direction
The only interesting qualities it has is
Alameda Slim could have potentially
been an interesting villian but his
potential is wasted on this movie. The
movie has moments where it is
ALMOST charming and then is
followed up with a dumb burp or fart
joke or something crude. Sorry to
anybody that likes the movie. It's ok if
you like it and that's vour choice but it
doesn't make the film a good movie. 12
on Wed Like Re More
Thomas John Allen replied 4 replies
i make 1 tweet about The Emperors New Groove and Laura went wild https://t.co/XCG8P328Tc]()
i make 1 tweet about The Emperors New Groove and Laura went wild https://t.co/XCG8P328Tc
Memes, Work, and Kardashian: me: *has lots of work to do*
me: *takes online quiz to see what
Kardashian I am*
I hope Iām @khloekardashian š¤š¼ goodgirlwithbadthoughts š
š¼
![Memes, Work, and Kardashian: me: *has lots of work to do*
me: *takes online quiz to see what
Kardashian I am*
I hope Iām @khloekardashian š¤š¼ goodgirlwithbadthoughts š
š¼]()
I hope Iām @khloekardashian š¤š¼ goodgirlwithbadthoughts š š¼
Wow, Golden Retriever, and Happy: Amy Sowerby
@amysowerby
My boyfriend was explaining to me how
its nice to be with me as l'm so easy to
keep happy. Enjoying the positive
comments l asked him to elaborate, he
says well all you need is to sleep well,
eat lots and go for nice walks, to which I
suddenly realised I am a golden retriever
wow, this is me
![Wow, Golden Retriever, and Happy: Amy Sowerby
@amysowerby
My boyfriend was explaining to me how
its nice to be with me as l'm so easy to
keep happy. Enjoying the positive
comments l asked him to elaborate, he
says well all you need is to sleep well,
eat lots and go for nice walks, to which I
suddenly realised I am a golden retriever
wow, this is me]()
wow, this is me
Queen Latifah, Life, and Love: Queen Latifah's Mother Rita
Owens Dies From Chronic Heart
Condition@balleralert
mao
Queen Latifahās Mother Rita Owens Dies From Chronic Heart Condition - blogged by @worldwidekeege ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Dana Owens a.k.a the great Queen Latifah, announced Wednesday that her mother, Rita Owens, has passed away from a severe heart condition that has been ailing her for more than a decade. ā ā ā ā ā ā ā ā ā ā ā ā ā ā "It is with a heavy heart that I share the news, my mother, Rita Owens passed away today... Anyone that has ever met her knows what a bright light she was on this earth. She was gentle, but strong, sweet, but sassy, worldly but pragmatic, a woman of great faith and certainly the love of my life.ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Heart failure is a chronic progressive condition where the heart is unable to pump blood efficiently through the body. Rita Owens was on medication, had a defibrillator implanted in her chest to prevent heart attacks, and a strict diet of low salts and fats with lots of vegetables. ā ā ā ā ā ā ā ā ā ā ā ā ā ā āShe had struggled with a heart condition for many years and her battle is now over... I am heartbroken but know she is at peace. Thank you for your kindness, support and respect for our privacy at this time. Much Love, Dana Owens (aka Queen Latifāah), forever Rita Owensā daughter.ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Latifah mentioned to PEOPLE in a previous interview in 2015 that when she was not in California, she was at her motherās New Jersey home helping with caregiving duties. ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā She broke the news to PEOPLE about her motherās death and impact on her life. ā ā ā ā ā ā ā ā ā ā ā ā ā ā "I watched her come through so many things, ups and downs, hospitalizations ā I mean really being in the ICU for that matter ā you know, going through tough times and watching her come back and bounce back and still maintain this sense of humor, and love and drive and will... I just love her so much more, I respect her so much more. She really just gives me hope for life and the world.ā Latifah said. ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā R.I.P. the great Rita Owens.
![Queen Latifah, Life, and Love: Queen Latifah's Mother Rita
Owens Dies From Chronic Heart
Condition@balleralert
mao
Queen Latifahās Mother Rita Owens Dies From Chronic Heart Condition - blogged by @worldwidekeege ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Dana Owens a.k.a the great Queen Latifah, announced Wednesday that her mother, Rita Owens, has passed away from a severe heart condition that has been ailing her for more than a decade. ā ā ā ā ā ā ā ā ā ā ā ā ā ā "It is with a heavy heart that I share the news, my mother, Rita Owens passed away today... Anyone that has ever met her knows what a bright light she was on this earth. She was gentle, but strong, sweet, but sassy, worldly but pragmatic, a woman of great faith and certainly the love of my life.ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Heart failure is a chronic progressive condition where the heart is unable to pump blood efficiently through the body. Rita Owens was on medication, had a defibrillator implanted in her chest to prevent heart attacks, and a strict diet of low salts and fats with lots of vegetables. ā ā ā ā ā ā ā ā ā ā ā ā ā ā āShe had struggled with a heart condition for many years and her battle is now over... I am heartbroken but know she is at peace. Thank you for your kindness, support and respect for our privacy at this time. Much Love, Dana Owens (aka Queen Latifāah), forever Rita Owensā daughter.ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Latifah mentioned to PEOPLE in a previous interview in 2015 that when she was not in California, she was at her motherās New Jersey home helping with caregiving duties. ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā She broke the news to PEOPLE about her motherās death and impact on her life. ā ā ā ā ā ā ā ā ā ā ā ā ā ā "I watched her come through so many things, ups and downs, hospitalizations ā I mean really being in the ICU for that matter ā you know, going through tough times and watching her come back and bounce back and still maintain this sense of humor, and love and drive and will... I just love her so much more, I respect her so much more. She really just gives me hope for life and the world.ā Latifah said. ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā R.I.P. the great Rita Owens.]()
Queen Latifahās Mother Rita Owens Dies From Chronic Heart Condition - blogged by @worldwidekeege ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā ā Dana Owens a.k.a the gr...
Girls, Trunks, and Glee: and y'all wonder why girls are so self
conscious.. This is not okay
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks
WO
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls a
follow my account @activismandstuff for more ! @activismandstuff @activismandstuff @activismandstuff
![Girls, Trunks, and Glee: and y'all wonder why girls are so self
conscious.. This is not okay
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks
WO
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls a
follow my account @activismandstuff for more ! @activismandstuff @activismandstuff @activismandstuff]()
nsfw
follow my account @activismandstuff for more ! @activismandstuff @activismandstuff @activismandstuff
Dumb, Love, and Memes: KO
MD
4
Daniela
Today 2:19 PM
Hola Lin! No tenemos nada de
seƱal ni comunicaciĆ³n. Tengo un
poco de seƱal cause we are en Sj
pero en Vega alta estamos
completely incomunicados.
We're okay and the goats are
okay. Lots of damage
everywhere pero estamos vivos
and that's what matters. Love
you
Love you too
This was my first contact with šµš· after the storm, text from my cousin Daniela. (she is studying to be a veterinarian and likes goats a lot more than people) An update on her dumb goats later today... https://t.co/1gelMIBDZQ
![Dumb, Love, and Memes: KO
MD
4
Daniela
Today 2:19 PM
Hola Lin! No tenemos nada de
seƱal ni comunicaciĆ³n. Tengo un
poco de seƱal cause we are en Sj
pero en Vega alta estamos
completely incomunicados.
We're okay and the goats are
okay. Lots of damage
everywhere pero estamos vivos
and that's what matters. Love
you
Love you too
This was my first contact with šµš· after the storm, text from my cousin Daniela. (she is studying to be a veterinarian and likes goats a lot more than people) An update on her dumb goats later today... https://t.co/1gelMIBDZQ]()
This was my first contact with šµš· after the storm, text from my cousin Daniela. (she is studying to be a veterinarian and likes goats a lot ...
Group Chat, Chat, and Snakes: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/Myz7zcG1Dg
![Group Chat, Chat, and Snakes: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/Myz7zcG1Dg]()
when you get ignored in the group chat https://t.co/Myz7zcG1Dg
Group Chat, Chat, and Snakes: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/RtTSDjclFJ
![Group Chat, Chat, and Snakes: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/RtTSDjclFJ]()
when you get ignored in the group chat https://t.co/RtTSDjclFJ
Funny, Group Chat, and Chat: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/29LUVodJaw
![Funny, Group Chat, and Chat: And there are snakes here,
too. Lots of them.
when you get ignored in the group chat https://t.co/29LUVodJaw]()
when you get ignored in the group chat https://t.co/29LUVodJaw
Money, Weed, and Marijuana: what i want: lots of money and weed
what i have: a mental illness
follow @dutchmasterscigars if youāre a stoner š„
![Money, Weed, and Marijuana: what i want: lots of money and weed
what i have: a mental illness
follow @dutchmasterscigars if youāre a stoner š„]()
follow @dutchmasterscigars if youāre a stoner š„
Memes, Period, and Word: SGAG
Red Lots Nos.
42 to 58
No parking for visitors
for this period
Mon to sun & public
holidays : Whole day
APAINIP
YOU COULD HAVEJUST
SAID NO PARKING FOFR
VISITORS"
Submitted by xx mhd sha xx
When you've a minimum word count to hit for your compo...
![Memes, Period, and Word: SGAG
Red Lots Nos.
42 to 58
No parking for visitors
for this period
Mon to sun & public
holidays : Whole day
APAINIP
YOU COULD HAVEJUST
SAID NO PARKING FOFR
VISITORS"
Submitted by xx mhd sha xx
When you've a minimum word count to hit for your compo...]()
When you've a minimum word count to hit for your compo...
Funny, Onion, and French: "and for the lady, perhaps a salad?"
uh perhaps not. I'll have the steak,
smothered in onions. a rack of ribs.
pasta with extra garlic. french fries with
lots of vinegar and a side of onion rings
with lots of sauerkraut.
@araslanian
You real if you know where this is from š
![Funny, Onion, and French: "and for the lady, perhaps a salad?"
uh perhaps not. I'll have the steak,
smothered in onions. a rack of ribs.
pasta with extra garlic. french fries with
lots of vinegar and a side of onion rings
with lots of sauerkraut.
@araslanian
You real if you know where this is from š]()
You real if you know where this is from š
Af, Dancing, and Instagram: Yung
@YungYinkv
One of my little cousins posts a video
of herself dancing 5x a day on
instagram & tags lots of famous
dancers & dance companies. She told
me that's how she's gonna get
discovered. I said "sis ur page is
private." And she said "yeah cuz l
don't need everybody in my business"
š¤£Legendary AF
![Af, Dancing, and Instagram: Yung
@YungYinkv
One of my little cousins posts a video
of herself dancing 5x a day on
instagram & tags lots of famous
dancers & dance companies. She told
me that's how she's gonna get
discovered. I said "sis ur page is
private." And she said "yeah cuz l
don't need everybody in my business"
š¤£Legendary AF]()
š¤£Legendary AF
![Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and Iām REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells donāt actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But hereās the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesnāt really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at āsequencing DNAā letter by letter, it is possible for you to learn how your DNA may differ from the personās next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we havenāt quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, itās important to keep asking questions about it and staying curious about the letters in your cells!](https://pics.onsizzle.com/tggaacttgaaggaggaactaaaagaagcggcttctaataaattctatagctaaggtcatcgaa-ggttacttattttttactttatttaggttgcctgatattcacttagtctggcctgctaaacatg-gacttttccagtatgcgtgg-30721976.png)
Condom, Dank, and Pregnant: HONEY... I THINK
M PREGNANT
GOOD THING 'VE
GOT THIS CONDOM
THEN. THEY PREVENT
PREGNANCIES!
THATS... NOT
HOW IT WORKS.
Cyanide and Happiness Ā© Explosm.net
By Rob. We have lots more comics over at www.explosm.net - thousands of them, in fact! Go check them out!
![Condom, Dank, and Pregnant: HONEY... I THINK
M PREGNANT
GOOD THING 'VE
GOT THIS CONDOM
THEN. THEY PREVENT
PREGNANCIES!
THATS... NOT
HOW IT WORKS.
Cyanide and Happiness Ā© Explosm.net
By Rob. We have lots more comics over at www.explosm.net - thousands of them, in fact! Go check them out!]()
By Rob. We have lots more comics over at www.explosm.net - thousands of them, in fact! Go check them out!
Lmao, Lol, and Love: jillian dradzynski
@jillianallyce
ls your child texting about
@olivegarden? Here's a quick guide to
find out:
OG: Olive Garden
LMAO: love me an olive
LOL: lots of lasagna
ROFL: ravioli or flavorful linguine
BRB: breadsticks rock, bro
WTF: where's the fettuccine
STFU: some tiramisu for us
@drgrayfang is by far the most savage page on IG
![Lmao, Lol, and Love: jillian dradzynski
@jillianallyce
ls your child texting about
@olivegarden? Here's a quick guide to
find out:
OG: Olive Garden
LMAO: love me an olive
LOL: lots of lasagna
ROFL: ravioli or flavorful linguine
BRB: breadsticks rock, bro
WTF: where's the fettuccine
STFU: some tiramisu for us
@drgrayfang is by far the most savage page on IG]()
@drgrayfang is by far the most savage page on IG
Latinos, Memes, and True: The phrase "you're not down"
has caused me lots of problems
True š FOLLOW USā”ļø @nochill_latinos
![Latinos, Memes, and True: The phrase "you're not down"
has caused me lots of problems
True š FOLLOW USā”ļø @nochill_latinos]()
True š FOLLOW USā”ļø @nochill_latinos
Crazy, Memes, and Smoking: When your mom says it smells
like weed and asks if you've been
smoking
@Top Tree
Crazy world. Lots of smells.
ā ļøWARNING ā ļø DONāT FOLLOW š @toptree if youāre easily offended @toptree !!!
![Crazy, Memes, and Smoking: When your mom says it smells
like weed and asks if you've been
smoking
@Top Tree
Crazy world. Lots of smells.
ā ļøWARNING ā ļø DONāT FOLLOW š @toptree if youāre easily offended @toptree !!!]()
ā ļøWARNING ā ļø DONāT FOLLOW š @toptree if youāre easily offended @toptree !!!
Bodies , Girls, and Queen Latifah: BEST & WORST
BEACH BODIES!
MARIAH
CAREY
The 46-year-
old pop diva
is a big star.
As in too
big for this
wetsuit!
WAY T
MUC
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks.
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf!
COLLINS
S 82!
QUEEN LATIFAH
BEACHED
WHALE
WOR
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls are
on her belly
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/0kprYPzjnj
![Bodies , Girls, and Queen Latifah: BEST & WORST
BEACH BODIES!
MARIAH
CAREY
The 46-year-
old pop diva
is a big star.
As in too
big for this
wetsuit!
WAY T
MUC
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks.
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf!
COLLINS
S 82!
QUEEN LATIFAH
BEACHED
WHALE
WOR
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls are
on her belly
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/0kprYPzjnj]()
nsfw
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/0kprYPzjnj
Bodies , Girls, and Queen Latifah: BEST & WORST
BEACH BODIES!
MARIAH
CAREY
The 46-year-
old pop diva
is a big star.
As in too
big for this
wetsuit!
WAY T
MUC
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks.
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf!
COLLINS
S 82!
QUEEN LATIFAH
BEACHED
WHALE
WOR
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls are
on her belly
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/b7wYlAY5ZM
![Bodies , Girls, and Queen Latifah: BEST & WORST
BEACH BODIES!
MARIAH
CAREY
The 46-year-
old pop diva
is a big star.
As in too
big for this
wetsuit!
WAY T
MUC
HUNT
d about Helen, 51,
d prefer she leave
om line behind!
TARA REID
Hard partying plus botched
surgery equal lots of extra junk
in this 39-year-old's trunks.
REBEL
WILSON
The stand-up
comedian, 29,
made a big
splash in Pitch
Perfect, and
does the same
when she hits
the surf!
COLLINS
S 82!
QUEEN LATIFAH
BEACHED
WHALE
WOR
ROLL PLAYER
LEA MICHELE
The 28-year-old
singer's most
famous role was
on Glee, but her
biggest rolls are
on her belly
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/b7wYlAY5ZM]()
nsfw
and yāall wonder why girls are so self conscious.. This is not okay https://t.co/b7wYlAY5ZM
