🔥 | Latest

Anaconda, Bailey Jay, and Baller Alert: Baller Alert's Today in Hip-Hop: Kanye West Released 'The College Dropout' 14 Years Ago @balleralert DD PARENTAL ADVISORY EXPLICIT CONTENT Baller Alert’s Today in Hip-Hop: Kanye West Released ‘The College Dropout’ 14 Years Ago-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ On Feb. 10, 2004, Kanye West released his debut studio album ‘The College Dropout’ on Roc-A-Fella Records and Def Jam Recordings. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ From 1999 to the year of its release, West spent years working on the project. While working on the album, West had already established himself as a producer having done production for artists such as Jay-Z and Talib Kweli. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Doing his own production, West created a masterpiece. Not only did he develop a new sound nicknamed “chipmunk soul," where he took R&B and Soul samples and sped them up, but his lyricism also introduced us to a new style. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ While many rappers of the time maintained the gangsta rap style we were used to, West instead introduced us to the story of the average joe who questions family, religion, politics, and more. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The singles from the album, "Through the Wire" and "Jesus Walks", were both critically acclaimed, while “All Falls Down" and "Slow Jamz" charted in the top 10 of the Billboard Hot 100. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Upon its release, the album debuted at number two on the US Billboard 200 chart having sold 441,000 copies in the first week. ‘The College Dropout’ received phenomenal reviews from multiple publications and even earned West 10 Grammy nominations. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Multiple publications such as Time and Rolling Stone have named it one of the greatest albums of all time.
Anaconda, Bailey Jay, and Baller Alert: Baller Alert's Today in Hip-Hop: Kanye
 West Released 'The College Dropout'
 14 Years Ago
 @balleralert
 DD PARENTAL
 ADVISORY
 EXPLICIT CONTENT
Baller Alert’s Today in Hip-Hop: Kanye West Released ‘The College Dropout’ 14 Years Ago-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ On Feb. 10, 2004, Kanye West released his debut studio album ‘The College Dropout’ on Roc-A-Fella Records and Def Jam Recordings. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ From 1999 to the year of its release, West spent years working on the project. While working on the album, West had already established himself as a producer having done production for artists such as Jay-Z and Talib Kweli. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Doing his own production, West created a masterpiece. Not only did he develop a new sound nicknamed “chipmunk soul," where he took R&B and Soul samples and sped them up, but his lyricism also introduced us to a new style. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ While many rappers of the time maintained the gangsta rap style we were used to, West instead introduced us to the story of the average joe who questions family, religion, politics, and more. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The singles from the album, "Through the Wire" and "Jesus Walks", were both critically acclaimed, while “All Falls Down" and "Slow Jamz" charted in the top 10 of the Billboard Hot 100. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Upon its release, the album debuted at number two on the US Billboard 200 chart having sold 441,000 copies in the first week. ‘The College Dropout’ received phenomenal reviews from multiple publications and even earned West 10 Grammy nominations. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Multiple publications such as Time and Rolling Stone have named it one of the greatest albums of all time.

Baller Alert’s Today in Hip-Hop: Kanye West Released ‘The College Dropout’ 14 Years Ago-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ On Feb. 10, 20...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Bad, Doctor, and Head: Gabby Douglas and Her Mom Speaks Out After Man Attempted to Attack Nassar irn Courtroom: "lt's a Bad Example for the Kids" @balleralert Gabby Douglas and Her Mom Speaks Out After Man Attempted to Attack Nassar in Courtroom: “It’s a Bad Example for the Kids” - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ While many may have been rooting for the man who nearly attacked Larry Nassar at his sentencing hearing, Gabby Douglas and her mom weren’t. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Earlier today, TMZ reported that Randall Margraves-the father of three of Nassar’s sexual assault victims, went completely berserk in a Michigan courtroom, lunging at the ex-USA team doctor head-on. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Shortly after, Margraves was handcuffed and escorted out, but he has since been released from custody and will not face any criminal charges. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, since the incident, several opinions have surrounded the matter, including a couple from Gabby Douglas-who was also sexually violated by Nassar, and her mother, Natalie Hawkins. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When asked by TMZ how she felt about the situation, Douglas actually stated that she didn’t think it was so much of a good idea to “repay evil with evil”, and she says that is something that she will “always stand by.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ But, Mama Hawkins, on the other hand, had a lot more to add to that. “What’s the example it’s setting for the kids? That it’s okay to attack because somebody attacks?” she questions. “That’s a bad example. It’s not what we should be teaching our kids. We have enough violence to endure. There’s enough. Enough is enough.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Hawkins then went on to indicate that, because her daughter was also a victim, she understood Margraves’ pain, but she still feels that it could’ve been handled better. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “My daughter was one of the [victims],” she reiterates. “I don’t care how angry you are, the important thing is for you to maintain your emotions. It’s a bad example for the kids.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to recent reports, following the occurrence, Margraves apologized, as he expressed that he “lost control” and “felt embarrassed” afterwards.
Bad, Doctor, and Head: Gabby Douglas and Her Mom Speaks Out
 After Man Attempted to Attack Nassar irn
 Courtroom: "lt's a Bad Example for the
 Kids"
 @balleralert
Gabby Douglas and Her Mom Speaks Out After Man Attempted to Attack Nassar in Courtroom: “It’s a Bad Example for the Kids” - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ While many may have been rooting for the man who nearly attacked Larry Nassar at his sentencing hearing, Gabby Douglas and her mom weren’t. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Earlier today, TMZ reported that Randall Margraves-the father of three of Nassar’s sexual assault victims, went completely berserk in a Michigan courtroom, lunging at the ex-USA team doctor head-on. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Shortly after, Margraves was handcuffed and escorted out, but he has since been released from custody and will not face any criminal charges. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, since the incident, several opinions have surrounded the matter, including a couple from Gabby Douglas-who was also sexually violated by Nassar, and her mother, Natalie Hawkins. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When asked by TMZ how she felt about the situation, Douglas actually stated that she didn’t think it was so much of a good idea to “repay evil with evil”, and she says that is something that she will “always stand by.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ But, Mama Hawkins, on the other hand, had a lot more to add to that. “What’s the example it’s setting for the kids? That it’s okay to attack because somebody attacks?” she questions. “That’s a bad example. It’s not what we should be teaching our kids. We have enough violence to endure. There’s enough. Enough is enough.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Hawkins then went on to indicate that, because her daughter was also a victim, she understood Margraves’ pain, but she still feels that it could’ve been handled better. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “My daughter was one of the [victims],” she reiterates. “I don’t care how angry you are, the important thing is for you to maintain your emotions. It’s a bad example for the kids.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to recent reports, following the occurrence, Margraves apologized, as he expressed that he “lost control” and “felt embarrassed” afterwards.

Gabby Douglas and Her Mom Speaks Out After Man Attempted to Attack Nassar in Courtroom: “It’s a Bad Example for the Kids” - blogged by: @ash...

Books, Friends, and Goals: COMMIT YOURSELF TO CONSTANT IMPROVEMENT. We are already in the second month of the year and most of you are pushing hard to improve themselves. (I assume) So if you want to imporve yourself, focus on improving these 4 areas of your life: - ✔️Financial. Most people would rather not look at their bank accounts. 😟 As a result, money ends up controlling them. They chase it. They can't hold on to it. They are constantly ad odds with money because they haven't developed a sense of discipline toward what they spend and what they save. ✔️Physical. How many years in a row have you said, "This year, I'm going to take better care of my body?" 🤔 I said it many times already… but I will say it again: If you feel good, you do good. ✔️Mental (Input) -How many books did you read last year? -How many podcasts did you listen to? -How many documentaries did you watch? -How many people did you take the time to learn from? When you really ask yourself these questions, especially over the course of a year, you usually find a severe lack of input. However, input is required in order to grow. And no matter how many goals you set for yourself, you have to realize that goals tend to mean more output. ✔️Personal projects Career, great. Friends, great. Physical health, great. Emotional well-being, great. What are you creating, for yourself? What personal projects are you working on? - Let me know what you guys think about this post! Comment below👇 - improvement motivation millionairementor
Books, Friends, and Goals: COMMIT YOURSELF
 TO CONSTANT
 IMPROVEMENT.
We are already in the second month of the year and most of you are pushing hard to improve themselves. (I assume) So if you want to imporve yourself, focus on improving these 4 areas of your life: - ✔️Financial. Most people would rather not look at their bank accounts. 😟 As a result, money ends up controlling them. They chase it. They can't hold on to it. They are constantly ad odds with money because they haven't developed a sense of discipline toward what they spend and what they save. ✔️Physical. How many years in a row have you said, "This year, I'm going to take better care of my body?" 🤔 I said it many times already… but I will say it again: If you feel good, you do good. ✔️Mental (Input) -How many books did you read last year? -How many podcasts did you listen to? -How many documentaries did you watch? -How many people did you take the time to learn from? When you really ask yourself these questions, especially over the course of a year, you usually find a severe lack of input. However, input is required in order to grow. And no matter how many goals you set for yourself, you have to realize that goals tend to mean more output. ✔️Personal projects Career, great. Friends, great. Physical health, great. Emotional well-being, great. What are you creating, for yourself? What personal projects are you working on? - Let me know what you guys think about this post! Comment below👇 - improvement motivation millionairementor

We are already in the second month of the year and most of you are pushing hard to improve themselves. (I assume) So if you want to imporve ...

Energy, Life, and Memes: LEARN FROM THE PAS AND MOVE FORWARD Those who choose to simply forget the past miss out on its fullest potential. There are valuable lessons to be learned from it. And those who choose to ask the right questions about their past are most prepared to live life to the fullest in the present. 😉 - Consider the lessons we can learn from our past. By simply asking the right questions, we can discover… ✔️Strengths that define us. The talents and abilities we use to navigate and provide value to this world define the lives we live and the change we can offer. And by recalling our strengths in the past, we can better recognize our opportunities in the present. ✔️Weaknesses that frustrate us. ‘We all have weaknesses in personality and competence. When left unaddressed, these weaknesses limit our potential for impact and significance. Discover them. Recognize them. And learn to overcome them by seeking the help of others. ✔️Habits that invigorate us. Over the course of our lives, we employ a variety of disciplines to make the most of it. We discover a new diet, a new fitness practice, or a new morning routine. We experiment with them. Some work, some don’t. Eventually, these new disciplines either become habits or they fade from our memory. Look back. Recognize the habits that brought energy, health, and invigoration into your life. And embrace them again. ✔️Motivations that compel us. Deep in our heart, our motivation runs supreme. It determines the decisions we make, the use of our time, and the words we choose to use. Understanding our deepest motivations is a difficult task. It requires stillness, patience, and consistent self-evaluation. But the more we discover why we do the things we do, the easier it is for us to make the most of the present we are living in today. - If we start asking the right questions, there are countless life-giving lessons we can learn from our past. Would you agree? Comment below!👇 - past success learn millionairementor
Energy, Life, and Memes: LEARN FROM THE PAS
 AND MOVE FORWARD
Those who choose to simply forget the past miss out on its fullest potential. There are valuable lessons to be learned from it. And those who choose to ask the right questions about their past are most prepared to live life to the fullest in the present. 😉 - Consider the lessons we can learn from our past. By simply asking the right questions, we can discover… ✔️Strengths that define us. The talents and abilities we use to navigate and provide value to this world define the lives we live and the change we can offer. And by recalling our strengths in the past, we can better recognize our opportunities in the present. ✔️Weaknesses that frustrate us. ‘We all have weaknesses in personality and competence. When left unaddressed, these weaknesses limit our potential for impact and significance. Discover them. Recognize them. And learn to overcome them by seeking the help of others. ✔️Habits that invigorate us. Over the course of our lives, we employ a variety of disciplines to make the most of it. We discover a new diet, a new fitness practice, or a new morning routine. We experiment with them. Some work, some don’t. Eventually, these new disciplines either become habits or they fade from our memory. Look back. Recognize the habits that brought energy, health, and invigoration into your life. And embrace them again. ✔️Motivations that compel us. Deep in our heart, our motivation runs supreme. It determines the decisions we make, the use of our time, and the words we choose to use. Understanding our deepest motivations is a difficult task. It requires stillness, patience, and consistent self-evaluation. But the more we discover why we do the things we do, the easier it is for us to make the most of the present we are living in today. - If we start asking the right questions, there are countless life-giving lessons we can learn from our past. Would you agree? Comment below!👇 - past success learn millionairementor

Those who choose to simply forget the past miss out on its fullest potential. There are valuable lessons to be learned from it. And those wh...

Beautiful, Bless Up, and Chicago: l just rescued this beautiful girl, and she is sleeping inside for the first time in her life Reddit u/CollectiveOfCells @DrSmashlove So I’m texting with my lil homegirl in Toronto and I’m like “aye y’all got Chil Fil A in Toronto 🤔” and she like “nah” and I’m like “aight when u slide thru Chicago it’s on” and she like “smash! We don’t fvck with Chik Fil A! 😤” And that’s when I had to stop her right there, bruv. See I don’t blame u Canadians because y’all really woke the long way but I gotta splain sum real quick. We all out here tryina make things right. U feel me? We all taking a stand. Against inequality. Against intolerance. I feel that. My fist in the air too, sis. BUT REVOLT HAS A LINE THAT CANNOT BE CROSSED AND THAT LINE IS CHIK FIL A 😐😂. Do I like they stance on same sex marriage? No. Do I like they tenders? Also no. I LOVE THEY TENDERS, BRUV. I PEEL OPEN THAT SRIRACHA SAUCE AND I PEEL OPEN THAT POLYNESIAN SAUCE AND I DUNK + TWIRL MY MEAT IN BOTH SAUCES - IN ALTERNATING FASHION - AS MY HEART (and belly, and eye) SHED A SINGLE TEAR OF HAPPINESS. But Smash, what if tomorrow they tweeted ‘Chik Fil A supports the Trump Travel Ban, go back to your country 😤.’ Well see now sis, extraordinary measures require extraordinary responses. I would go directly to my jeweler Tony on Wabash. I would say “Tony my dude imma need a cross.” Tony: “smash...you don’t wear crosses(?)” Me: “TONY GIMME THE CROSS AND STOP AXING QUESTIONS. MAKE SURE IT GOT JESUS ON IT. Put diamonds in the thorns too 🙂.” And I would stroll to Chik Fil A on State Street. And put that cross on, go in and say “two orders of tenders and a peach milkshake please.” The black cashier would eye me. I would eye her back. I would look down. I would look back up and see her shaking her head: “smash...I served u daily during Ramadan. DAILY. In here like a crack addict at sundown in your suit - 8:32 pm on the dot I’m handing you tenders. And you’re back? After what they said about the trump ban? Wearing a CROSS(?)” And I would, with a solemn stare, mouth the following words “sis...issa time to fight and it’s a time to eat. The only thing standing between me and the dinner God hath planned for me is you. YOU COULD CATCHETH THESE HANDS. Glory be to Jesus.” BLESS UP 😩😍😂😂😂
Beautiful, Bless Up, and Chicago: l just rescued this beautiful girl, and she is
 sleeping inside for the first time in her life
 Reddit u/CollectiveOfCells
 @DrSmashlove
So I’m texting with my lil homegirl in Toronto and I’m like “aye y’all got Chil Fil A in Toronto 🤔” and she like “nah” and I’m like “aight when u slide thru Chicago it’s on” and she like “smash! We don’t fvck with Chik Fil A! 😤” And that’s when I had to stop her right there, bruv. See I don’t blame u Canadians because y’all really woke the long way but I gotta splain sum real quick. We all out here tryina make things right. U feel me? We all taking a stand. Against inequality. Against intolerance. I feel that. My fist in the air too, sis. BUT REVOLT HAS A LINE THAT CANNOT BE CROSSED AND THAT LINE IS CHIK FIL A 😐😂. Do I like they stance on same sex marriage? No. Do I like they tenders? Also no. I LOVE THEY TENDERS, BRUV. I PEEL OPEN THAT SRIRACHA SAUCE AND I PEEL OPEN THAT POLYNESIAN SAUCE AND I DUNK + TWIRL MY MEAT IN BOTH SAUCES - IN ALTERNATING FASHION - AS MY HEART (and belly, and eye) SHED A SINGLE TEAR OF HAPPINESS. But Smash, what if tomorrow they tweeted ‘Chik Fil A supports the Trump Travel Ban, go back to your country 😤.’ Well see now sis, extraordinary measures require extraordinary responses. I would go directly to my jeweler Tony on Wabash. I would say “Tony my dude imma need a cross.” Tony: “smash...you don’t wear crosses(?)” Me: “TONY GIMME THE CROSS AND STOP AXING QUESTIONS. MAKE SURE IT GOT JESUS ON IT. Put diamonds in the thorns too 🙂.” And I would stroll to Chik Fil A on State Street. And put that cross on, go in and say “two orders of tenders and a peach milkshake please.” The black cashier would eye me. I would eye her back. I would look down. I would look back up and see her shaking her head: “smash...I served u daily during Ramadan. DAILY. In here like a crack addict at sundown in your suit - 8:32 pm on the dot I’m handing you tenders. And you’re back? After what they said about the trump ban? Wearing a CROSS(?)” And I would, with a solemn stare, mouth the following words “sis...issa time to fight and it’s a time to eat. The only thing standing between me and the dinner God hath planned for me is you. YOU COULD CATCHETH THESE HANDS. Glory be to Jesus.” BLESS UP 😩😍😂😂😂

So I’m texting with my lil homegirl in Toronto and I’m like “aye y’all got Chil Fil A in Toronto 🤔” and she like “nah” and I’m like “aight w...