πŸ”₯ | Latest

College, Girls, and Memes: cience | guff.com This woman proved the existence of dark matter Today is International Day of Women and Girls in Science. πŸ‘©β€πŸ”¬ In the spirit of today, @Science wanted to honor Vera Rubin, an amazing American astronomer! How’s that for alliteration? She was born in Philadelphia and grew up with an interest in astronomy. Rubin eventually earned her BA in astronomy from Vassar College and tried to enroll in the graduate astronomy program at Princeton, but they refused to send her a catalogue because women weren’t allowed in the graduate astronomy program...until 1975. Let’s let that sink in for a second. She ended up studying at Cornell University, learning quantum physics from Richard Feynman and quantum mechanics under Hans Bethe. While studying the Andromeda Galaxy with fellow astronomer Kent Ford, Rubin noticed that objects on the outer parts of the galaxy were spinning at the same speed as those on the inside, which was antithetical to the belief objects at the center of a galaxy move faster than those on the outskirts. It turns out that she discovered the existence of the unseeable stuff that affects the movement of galaxies! . . Give a shout-out to your favorite women in the field of Science in the comments below. πŸ‘©β€πŸ”¬β¬‡οΈβ¬‡οΈβ¬‡οΈ . Science Physics DarkMatter WomenInSTEM Scientists VeraRubin BestOf WomebInScience
College, Girls, and Memes: cience | guff.com
 This woman proved the existence
 of dark matter
Today is International Day of Women and Girls in Science. πŸ‘©β€πŸ”¬ In the spirit of today, @Science wanted to honor Vera Rubin, an amazing American astronomer! How’s that for alliteration? She was born in Philadelphia and grew up with an interest in astronomy. Rubin eventually earned her BA in astronomy from Vassar College and tried to enroll in the graduate astronomy program at Princeton, but they refused to send her a catalogue because women weren’t allowed in the graduate astronomy program...until 1975. Let’s let that sink in for a second. She ended up studying at Cornell University, learning quantum physics from Richard Feynman and quantum mechanics under Hans Bethe. While studying the Andromeda Galaxy with fellow astronomer Kent Ford, Rubin noticed that objects on the outer parts of the galaxy were spinning at the same speed as those on the inside, which was antithetical to the belief objects at the center of a galaxy move faster than those on the outskirts. It turns out that she discovered the existence of the unseeable stuff that affects the movement of galaxies! . . Give a shout-out to your favorite women in the field of Science in the comments below. πŸ‘©β€πŸ”¬β¬‡οΈβ¬‡οΈβ¬‡οΈ . Science Physics DarkMatter WomenInSTEM Scientists VeraRubin BestOf WomebInScience

Today is International Day of Women and Girls in Science. πŸ‘©β€πŸ”¬ In the spirit of today, @Science wanted to honor Vera Rubin, an amazing Americ...

Africa, Black History Month, and Community: Petition Asks Marvel to Invest 25% of "Black Panther" Profits into the Black Community @balleralert Petition Asks Marvel to Invest 25% of β€œBlack Panther” Profits into the Black Community-blogged by @thereal__bee β €β €β €β €β €β €β €β €β € β €β € As one of the most highly anticipated films of the year, β€œBlack Panther” is expected to break some box office records and bring in millions. But now a petition has begun to have part of the profits be invested in the Black community. β €β €β €β €β €β €β €β €β € β €β € A petition on Change.org is asking Marvel to invest 25 percent of the profits into Black communities. Creator of the petition, Chaz Gormley wrote, "Through a clever, well-manufactured marketing campaign Marvel Studios and their parent company The Walt Disney Company have targeted the Black community with their advertisements for the upcoming Black Panther film, due to release on February 16, 2018. As marginalized groups have become more vocal, corporations and their savvy public relations departments have turned to catering to these groups - to turn a profit - and this film by Marvel Studios is no different." β €β €β €β €β €β €β €β €β € β €β € Gormley also notes Marvel’s obvious appeals to the black community such as the film being released during Black History Month and Gil Scott-Heron's β€˜The Revolution Will Not Be Televised’ playing in the film's initial trailer. β €β €β €β €β €β €β €β €β € β €β € The petition is asking those in the Black community to regain their power and demand that Marvel and its parent company, Disney, invest profits back into the community that is most connected with the film and have been faced with β€œpolice brutality and substandard living conditions." β €β €β €β €β €β €β €β €β € β €β € "You have the ability to not only be entertained but to leave the theater in February knowing that a portion of your money will be coming back into your community" Gormley adds. β €β €β €β €β €β €β €β €β € β €β € "To not only go see a film about a fictitious country in Africa with advanced technology but the opportunity to invest in programs which focus on the fields - Science, Technology, Engineering, and Mathematics - that make such advancements possible, in real life.” β €β €β €β €β €β €β €β €β € β €β € What do you think about this idea?
Africa, Black History Month, and Community: Petition Asks Marvel to Invest 25% of
 "Black Panther" Profits into the Black
 Community
 @balleralert
Petition Asks Marvel to Invest 25% of β€œBlack Panther” Profits into the Black Community-blogged by @thereal__bee β €β €β €β €β €β €β €β €β € β €β € As one of the most highly anticipated films of the year, β€œBlack Panther” is expected to break some box office records and bring in millions. But now a petition has begun to have part of the profits be invested in the Black community. β €β €β €β €β €β €β €β €β € β €β € A petition on Change.org is asking Marvel to invest 25 percent of the profits into Black communities. Creator of the petition, Chaz Gormley wrote, "Through a clever, well-manufactured marketing campaign Marvel Studios and their parent company The Walt Disney Company have targeted the Black community with their advertisements for the upcoming Black Panther film, due to release on February 16, 2018. As marginalized groups have become more vocal, corporations and their savvy public relations departments have turned to catering to these groups - to turn a profit - and this film by Marvel Studios is no different." β €β €β €β €β €β €β €β €β € β €β € Gormley also notes Marvel’s obvious appeals to the black community such as the film being released during Black History Month and Gil Scott-Heron's β€˜The Revolution Will Not Be Televised’ playing in the film's initial trailer. β €β €β €β €β €β €β €β €β € β €β € The petition is asking those in the Black community to regain their power and demand that Marvel and its parent company, Disney, invest profits back into the community that is most connected with the film and have been faced with β€œpolice brutality and substandard living conditions." β €β €β €β €β €β €β €β €β € β €β € "You have the ability to not only be entertained but to leave the theater in February knowing that a portion of your money will be coming back into your community" Gormley adds. β €β €β €β €β €β €β €β €β € β €β € "To not only go see a film about a fictitious country in Africa with advanced technology but the opportunity to invest in programs which focus on the fields - Science, Technology, Engineering, and Mathematics - that make such advancements possible, in real life.” β €β €β €β €β €β €β €β €β € β €β € What do you think about this idea?

Petition Asks Marvel to Invest 25% of β€œBlack Panther” Profits into the Black Community-blogged by @thereal__bee β €β €β €β €β €β €β €β €β € β €β € As one of the m...

Albert Einstein, America, and Blackhistory: Albert Einstein teaching a physics class at Lincoln University (HBCU in Pennsylvania) in 1946. The Nobel prize winning scientist said: "The separation of the races is not a disease of colored people. It is a disease of white people. I do not intend to be quiet about it." Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 1. Shortly before moving to America, Einstein backed a campaign to defend the Scottsboro Boys, nine Alabama teenagers who were falsely accused of rape in 1931. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 2. When Princeton's Nassau Inn refused to rent a room to contralto opera star Marian Anderson because of her skin color, Einstein invited the singer home as his guest. Their friendship lasted from 1937 until his death in 1955, and Anderson stayed with the Einsteins whenever she visited Princeton. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 3. In 1946, Einstein gave a rare speech at Lincoln University in Pennsylvania, a historically black university, where he also accepted an honorary degree. The appearance was significant because Einstein made a habit of turning down all requests to speak at universities. During his speech, he called racism "a disease of white people." β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 4. Einstein was a friend and supporter of African-American actor and singer Paul Robeson, who was blacklisted because of his civil rights work. The pair worked together in 1946 on an anti-lynching petition campaign. In 1952, when Robeson's career had bottomed out because of the blacklisting, Einstein invited Robeson to Princeton as a rebuke to the performer's public castigation. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 5. For decades, Einstein offered public encouragement to the National Association for the Advancement of Colored People (NAACP) and its founder, W. E. B. Du Bois. And in 1951, when the federal government indicted the 83-year-old Du Bois as a "foreign agent," Einstein offered to appear as a character witness during the trial. The potential publicity convinced the judge to drop the case. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 6. In January 1946, Einstein published an essay, "The Negro Question," in Pageant magazine in which he called racism America's "worst disease." . AlbertEinstein BlackHistory BlackHistoryMonth BlackBoyJoy BlackGirlMagic physics einstein science history pennsylvania
Albert Einstein, America, and Blackhistory: Albert Einstein teaching a physics class at
 Lincoln University (HBCU in Pennsylvania)
 in 1946. The Nobel prize winning scientist
 said: "The separation of the races is not a
 disease of colored people. It is a disease of
 white people. I do not intend to be quiet
 about it."
Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 1. Shortly before moving to America, Einstein backed a campaign to defend the Scottsboro Boys, nine Alabama teenagers who were falsely accused of rape in 1931. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 2. When Princeton's Nassau Inn refused to rent a room to contralto opera star Marian Anderson because of her skin color, Einstein invited the singer home as his guest. Their friendship lasted from 1937 until his death in 1955, and Anderson stayed with the Einsteins whenever she visited Princeton. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 3. In 1946, Einstein gave a rare speech at Lincoln University in Pennsylvania, a historically black university, where he also accepted an honorary degree. The appearance was significant because Einstein made a habit of turning down all requests to speak at universities. During his speech, he called racism "a disease of white people." β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 4. Einstein was a friend and supporter of African-American actor and singer Paul Robeson, who was blacklisted because of his civil rights work. The pair worked together in 1946 on an anti-lynching petition campaign. In 1952, when Robeson's career had bottomed out because of the blacklisting, Einstein invited Robeson to Princeton as a rebuke to the performer's public castigation. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 5. For decades, Einstein offered public encouragement to the National Association for the Advancement of Colored People (NAACP) and its founder, W. E. B. Du Bois. And in 1951, when the federal government indicted the 83-year-old Du Bois as a "foreign agent," Einstein offered to appear as a character witness during the trial. The potential publicity convinced the judge to drop the case. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 6. In January 1946, Einstein published an essay, "The Negro Question," in Pageant magazine in which he called racism America's "worst disease." . AlbertEinstein BlackHistory BlackHistoryMonth BlackBoyJoy BlackGirlMagic physics einstein science history pennsylvania

Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. β”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆβ”ˆ 1. Shortly before moving to America, Eins...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at β€œsequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at β€œsequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

College, Fire, and Life: Let's Talk: Does The College Degree Still Hold Weight? @balleralert tate lIniurraity lniversity caulty habe confer Let’s Talk: Does The College Degree Still Hold Weight?- blogged by @lanaladonna β €β €β €β €β €β €β € β €β €β €β €β €β €β € Postgrad blues have set in. Do you hear me? It has left me thinking about the decision I made to go off to college to pursue a career in….. well, that may just be the problem. β €β €β €β €β €β €β € β €β €β €β €β €β €β € Now before you all jump down my throat, this conversation excludes those who went to school for education, medicine, accounting, engineering, and-or computer science, or any other field of genius..ism. β €β €β €β €β €β €β € β €β €β €β €β €β €β € For those who did not go to school for any of the above, now that you’ve graduated and are doing what you’re doing, was it really worth it? β €β €β €β €β €β €β € β €β €β €β €β €β €β € More recent than not, the thoughts of all the money and time that were wasted while at an institution to get this degree that everyone told me I needed has been heavy on my mind. It’s a known fact that now more than ever, people are starting up their own businesses, and financing their lifestyles via niches and trades of their own. No degree in sight. β €β €β €β €β €β €β € β €β €β €β €β €β €β € Here I am, a recent graduate, and on a hunt for work. Because of this, I now wish I was less naive when I was graduating from high school. Social media has been a fire engine for businesses everywhere. You don’t need a degree to market yourself these days or to pursue your dreams in entertainment, business, etc. Not to mention the infamous β€œInstagram model,” who are getting paid to do…. What do they do again? β €β €β €β €β €β €β € β €β €β €β €β €β €β € Education is important, yes, but in today’s world, it’s all about the schmoney, and right now, I owe a lot of that to my university. β €β €β €β €β €β €β € β €β €β €β €β €β €β € College comes with obstacles, only those who have gone can relate to this. Yes, you have a great time. Yes, you meet great people, and yes you learn a lot about yourself, but life provides that anyways… right? β €β €β €β €β €β €β € β €β €β €β €β €β €β € Don’t get it twisted - my degree is appreciated, and I am proud of myself for doing something a lot of people can’t do, but now I can’t help but to think - was it really worth it? β €β €β €β €β €β €β € β €β €β €β €β €β €β € What are some of your thoughts on college?
College, Fire, and Life: Let's Talk: Does The College
 Degree Still Hold Weight?
 @balleralert
 tate lIniurraity
 lniversity
 caulty
 habe confer
Let’s Talk: Does The College Degree Still Hold Weight?- blogged by @lanaladonna β €β €β €β €β €β €β € β €β €β €β €β €β €β € Postgrad blues have set in. Do you hear me? It has left me thinking about the decision I made to go off to college to pursue a career in….. well, that may just be the problem. β €β €β €β €β €β €β € β €β €β €β €β €β €β € Now before you all jump down my throat, this conversation excludes those who went to school for education, medicine, accounting, engineering, and-or computer science, or any other field of genius..ism. β €β €β €β €β €β €β € β €β €β €β €β €β €β € For those who did not go to school for any of the above, now that you’ve graduated and are doing what you’re doing, was it really worth it? β €β €β €β €β €β €β € β €β €β €β €β €β €β € More recent than not, the thoughts of all the money and time that were wasted while at an institution to get this degree that everyone told me I needed has been heavy on my mind. It’s a known fact that now more than ever, people are starting up their own businesses, and financing their lifestyles via niches and trades of their own. No degree in sight. β €β €β €β €β €β €β € β €β €β €β €β €β €β € Here I am, a recent graduate, and on a hunt for work. Because of this, I now wish I was less naive when I was graduating from high school. Social media has been a fire engine for businesses everywhere. You don’t need a degree to market yourself these days or to pursue your dreams in entertainment, business, etc. Not to mention the infamous β€œInstagram model,” who are getting paid to do…. What do they do again? β €β €β €β €β €β €β € β €β €β €β €β €β €β € Education is important, yes, but in today’s world, it’s all about the schmoney, and right now, I owe a lot of that to my university. β €β €β €β €β €β €β € β €β €β €β €β €β €β € College comes with obstacles, only those who have gone can relate to this. Yes, you have a great time. Yes, you meet great people, and yes you learn a lot about yourself, but life provides that anyways… right? β €β €β €β €β €β €β € β €β €β €β €β €β €β € Don’t get it twisted - my degree is appreciated, and I am proud of myself for doing something a lot of people can’t do, but now I can’t help but to think - was it really worth it? β €β €β €β €β €β €β € β €β €β €β €β €β €β € What are some of your thoughts on college?

Let’s Talk: Does The College Degree Still Hold Weight?- blogged by @lanaladonna β €β €β €β €β €β €β € β €β €β €β €β €β €β € Postgrad blues have set in. Do you hear me? ...

America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, β€œonce in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, β€œonce in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)

SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East...